... 2D- PAGE database dehydrogenase and to mitochondrial ATP synthase a subunit by comparison with 2D electrophoresis (2-DE) maps available in the SWISS 2D- PAGE database (http://www.expasy.org) Additionally, ... of a PD model Fig A representative silver-stained 2-DE gel of proteins extracted from b-gal cells treated with catalase (cat) Qualitative differences are indicated by squares (A: ATP synthase a; ... with a Universal Microplate reader Model 550 (Bio-Rad, Hercules, CA, USA) All experiments were run in triplicate 2-DE electrophoresis and statistical analysis a- Syn and b-gal cells treated or...
... sequence kanji katakana katakana-kanji kanji-hiragana hiragana kanji-katakana kat akana-symbol-katakana number kanji-hiragana-kanji alphabet kanji-hir agana-kanji-hir agana hiragana-kanji percent ... present a statistical model of Japanese unknown words using word morphology and word context We find that Japanese words are better modeled by classifying words based on the character sets (kanji, ... < a l p h a > , < h i r a > , < k a t a > , and < k a n > represent a sequence of symbols, numbers, alphabets, hiraganas, katakanas, and kanjis, respectively < k a n - h i r a > and < h i r a...
... collected and washed with PBS for three times again Total mRNA was extracted from collected H9 cells, days EB and days EB colonies using RNeasy Kit (QIAGEN, Chatsworth, CA, USA) cDNA was synthesized ... OCT4 F: CGRGAAGCTGGAGGAGAAGGAGAAGCTG 55 oC R: AAGGGCCGCAGCTTACACATGTTC NANOG F: GGCAAACAACCCACTTCTGC 55 oC R: TGTTCCAGGCCTGATTGTTC β-ACTIN F: ACAGAGCCTCGCCTTTGCC 58 oC R: ACATGCCGGAGCCGTTGTC 2.1.5 ... ISO 10993 standards DMSO was used as control MTS assay is a standard laboratory colorimetric assay that measures the activity of mitochondrial activity Enzyme reductase from mitochondria converts...
... than 1000 data points The data points were derived from Yahoo! Finance The data points were used to obtain abnormal returns (alpha), beta and residual variance of each of the above mentioned ... for date range were not entirely accurate The method to calculate the days, DaysCalculator(Date, Date), does not consider the fact that the index does not work on - 29 - weekends and bank holidays ... file and close - 37 - Appendix – User guide Download and save the data files as mentioned in Appendix Launch the software package Select FTSE from the symbol list, select the date range and then...
... experiment During and immediately following the melt, additional quantities of acetone, carbon dioxide, and other volatiles evolved, which indicates thermal degradation Thermal degradation after the ... melt and creates an uncertain baseline Second, the varying quantities of water in the starting material (Form I) result Table Summary of DSC data, suggested results, and additional characterizations ... anhydrous Form I and anhydrous Form II Hygroscopicity studies performed at 52% and 100% relative humidity (RH) indicated that Form I formed a heptahydrate at typical laboratory temperatures and...
... candidate word graph semantically checks and interprets the relationships, based on the world model 'Bunsetsu' sequences of a Japanese-language sentence are relatively arbitrary And conversational ... usinga $class facet and mapping information to the database schema usinga Sstorage facet The value of a Sstorage facet denotes the class name which has mapping information The sales class has ... part of the world model for a sales domain The commodity class has two attribute classes, commodity's name and fixed price The beer and whisky classes are subclasses of the commodity class and...
... one automaton per candidate episode All automata are initialized at the start of every sequence, Xi ∈ DY , and the automata make transitions whenever suitable events appear as we proceed down ... destroying the salient aspects of search behavior that are necessary for predictive analysis Downey et al [3] already introduced formal models and languages that encode search behavior as character sequences, ... between frequent itemsets and generative models has already been established [7]) A mixture of generative models for transaction databases also has a wide range of applications We will explore these...
... functionalized and activated nanoisland In the first step, a mixed self-assembled monolayer (SAM) of MPA and DT on the gold nanoisland was prepared by treatment with different volumetric ratios ... binary SAM containing MPA and DT was fabricated on the gold nanoislands Because the two thiol derivaties, MPA and DT, have different hydrophilicities as well as different chain lengths, the nanometerscale ... cm) in a vacuum at a temperature of 65°C The substrate was then annealed at 200°C for h to produce more stable and ordered gold nanoislands Two different types of gold nanoislands (1- and 5-nm thickness)...
... various observation methods and techniques are discussed of A trench and an observation window tested in order to estimate root distribution and growth in a natural oak-birch stand in central ... square (4 on the &dquo;right&dquo; side, numbered 4, and on &dquo;left&dquo; side, numbered - 5-8) Additional data : to simplify tedious elongation measurements, an attempt was made to use infrared ... any vector h, the mathematical expectancy and variance of the increment F(X + h) - F(X) are of X and depend only on h independant The variogram g(h) is half the secondorder moment of the random...
... event simulation (DES) has been found to be very effective (e.g Ahuja and Nandakumar, 1985; Chua and Li, 2002; Lee and Arditi, 2006; Senior, 1995) As argued by Lee and Arditi (2006), discrete event ... Formulation andModel Development with GA Search Approach Result and Analysis Chapter Seven: Case Study Result and Analysis Optimal Strategy for Overlapping Chapter Eight: Conclusions and Recommendations ... produced by a preceding activity, whereas a mark above the diagonal represents that an activity is dependent on Table 2.1 DSM in order to show the dependency Activity A1 A2 A3 A4 A5 A6 A7 A1 A2 ...
... Antarctic Territories Wallis and Futuna Islands Mayotte Saint Pierre and Miquelon Aruba Netherlands Antilles Anguilla Cayman Islands Falkland Islands South Georgia and South Sandwich Islands ... Conga Djibouti Egypt Southern Africa Eritrea Ethiopia Kenya Madagascar Malawi Mauritius Namibia Rwanda Seychelles Sudan Swaziland Uganda Zambia Zimbabwe East African Cooperation Kenya Tanzania ... Korea Romania Singapore Sri Lanka Sudan Thailand Trinidad and Tobago Tunisia United Republic of Tanzania Uruguay Venezuela Vietnam Yugoslavia Zaire Zimbabwe Latin American Integration Association...
... Chandler and Tempe, Arizona; Gresham, Oregon and design centers in California and India The Company’s quality system processes and procedures are for its PIC® MCUs and dsPIC® DSCs, KEELOQ® code ... The PMSM mathematical modeling depends on its topology, differentiating mainly two types: surface-mounted and interior permanent magnet Each type has its own advantages and disadvantages with ... which are read every estimator cycle The stator’s inductance (LS) and resistance (RS) in Equation 4, are normalized and adapted to ease the computation and to satisfy the software representation...
... consider the boundary value b j,i-1 and modify our transition assumptions for P ROMODES H in such a way that the new algorithm applies a first-order boundary modelanda second-order transition model ... calibrated threshold Conclusions We have presented a method to learn a calibrated decision threshold from a validation set and demonstrated that ensemble methods in connection with calibrated decision ... analysis based on relative word positions and found out that the calibrated P ROMODES -H predicted non-boundaries better for initial word positions whereas the calibrated P ROMODES for midand...
... This leads to the demand that we have to calibrate and validate the hydrological modelusing the individual storm events The traditional calibration method with the event data is trialand-error, ... evaporation data as input for the model The daily evaporation data at Khe Sanh station were used as inputs for the model For the model calibration and verification, discharge data is required The study ... study is MIKE-NAM model There are nine main parameters needed to calibrate and verify in this model Data required by the model include rainfall, evaporation and discharge In order to illustrate...
... Immunohistochemicalpsoriasis xenograft SCIDbiopsy before (A, B and C) transplantation and after (D, E and F) transplantation Immunohistochemical stainings of a keratome biopsy before (A, B and C) transplantation ... PHK did the immunohistochemical evaluations, LS designed and conducted the animal studies, OH did the statistical analysis, VH organised the clinical study, KK and MAR participated in the design ... tolerated and no significant weight loss was observed Two hours after the last application, the animals were bled and sacrificed The serum levels of calcipotriol and BDP were analyzed and determined...
... gene-expression data The tool has been demonstrated on artificial data and yeast cell-cycle gene-expression data Using the yeast microarray data, we have illustrated that our model can help identify regulatory ... earlier work we developed a state-space model with time delay to model yeast cell-cycle data [12], and the model was demonstrated on nonreplicated data Our previous method [12] emphasized identification ... 3.1 Data Sets Two data sets are used in this study First, an artificial data set is created to validate the model There are several methods proposed in the literature to create appropriate artificial...
... (unpublished data) ” ” Unpublished data Default Gond (unpublished data) Sampson (unpublished data) Sampson (unpublished data) ” Janssens (unpublished data) Default Default Minimum cuticular stomatal ... this sand layer, at a depth of 1.5 to m, lies a clay lens (Tiglian) and, deeper still, more sand (sands of Brasschaat, Pretiglian; [2]) The soil has been described as a moderately wet sandy soil ... exercise as discussed below Daily C and N inputs and outputs from the surface and soil sub-module are determined by needle litter-fall (C and N), fine root turnover (C and N), root exudation (C), and...
... This leads to the demand that we have to calibrate and validate the hydrological modelusing the individual storm events The traditional calibration method with the event data is trialand-error, ... study is MIKE-NAM model There are nine main parameters needed to calibrate and verify in this model Data required by the model include rainfall, evaporation and discharge In order to illustrate ... optima parameters of each event and therefore, the parameter space for the task of trial-anderror is narrowed Verification: According to Refsgaard (1996), amodel is said to be validated if its accuracy...