0

cõu 6 hóy trỡnh by cỏc vn c bn ca cụng tỏc qun tr nhõn s cho vớ d minh ha

Slide sinh 6 vai trò của thực vật đối với động vật và với đời sống con người _Gv Đ.T Hà

Slide sinh 6 vai trò của thực vật đối với động vật và với đời sống con người _Gv Đ.T

Trung học cơ sở - phổ thông

... Th c vật cung c p nơi mà cung c p nơi sinh s n cho s động vật Em lựa chọn đáp án cho c u hỏi sau: Những loài động vật sau ăn th c vật? A) Tr u, Bò, D , Chó s i B) Khỉ, S tử, S c, Chuột C) Chim ... vật s d ng tr nh hô hấp Quan s t hình ảnh video ý quan s t th c ăn động vật Quan s t hình sau C c em quan s t video sau: Em lựa chọn c u tr lời nhất: C c chất hữu th c vật chế tạo c vai tr ... Th c vật c vai tr đời s ng động vật ? A) Cung c p th c ăn B) Cung c p nơi th c ăn C) Cung c p th c ăn, khí oxi, nơi ở, nơi sinh s n D) Cung c p chất dinh d ỡng, th c ăn, nơi sinh s ng loài...
  • 47
  • 1,853
  • 0
Bài 6: Cách mạng công nghiệp (ban C) lớp 11

Bài 6: Cách mạng công nghiệp (ban C) lớp 11

Lịch sử

... kéo s i chạy nư c c- crai-tơ Máy kéo s i 1771: xưởng d t Anh đời 1785: Ét-mơn C c- rai phát minh máy d t chạy s cc đưa suất tăng 40 lần so với d t tay Ét-mơn C c- rai Ét-mơn C c- rai Máy d t ... BÀI 6: C CH MẠNG C NG NGHIỆP (nửa sau kỉ XVIII – kỉ XIX) NỘI DUNG I- C CH MẠNG C NG NGHIỆP Ở ANH a Những tiền đề c ch mạng c ng nghiệp b S phát minh s d ng máy m c II- C CH MẠNG C NG NGHIỆP ... PHÁP, Đ C III- HỆ QUẢ C A C CH MẠNG C NG NGHIỆP I- C CH MẠNG C NG NGHIỆP Ở ANH a Tiền đề c ch mạng  Anh nư c khởi đầu c ch mạng c ng nghiệp s m nhất, thuận lợi:  Tư  Nhân c ng  S phát triển...
  • 25
  • 1,006
  • 5
Tài liệu C# và Các Lớp Đối Tượng part 6 docx

Tài liệu C# và Các Lớp Đối Tượng part 6 docx

Kỹ thuật lập trình

... lastModifiedAttrib.DateModified; if (modifiedDate < backDateTo) return; AddToMessage(" MODIFIED: " + modifiedDate.ToLongDateString() + ":"); AddToMessage(" " + lastModifiedAttrib.Changes); if (lastModifiedAttrib.Issues ... ta c n s d ng đối tượng Stringbuilder lần nữa: using System; using System.Reflection; using System.Windows.Forms; using System.Text; using Wrox.ProCSharp.VectorClassembly; using Wrox.ProCSharp.WhatsNewAttributes; ... LookUpWhatsNew.cs lệnh để biên d ch : csc /reference:WhatsNewAttributes.dll /reference:VectorClassembly.dll LookUpWhatsNew.cs Trong phần mã tập tin ,đầu tiên ta định namespace ta muốn d ng, c system.Text...
  • 10
  • 369
  • 0
Tài liệu Báo cáo khoa học: Altered inactivation pathway of factor Va by activated protein C in the presence of heparin doc

Tài liệu Báo cáo khoa học: Altered inactivation pathway of factor Va by activated protein C in the presence of heparin doc

Báo cáo khoa học

... inhibitors/substrates, the peptide bond to be cleaved tends to be located on a loop structure that protrudes far outside the molecular surface, either because this loop is indeed ill-structured or because its conformation ... APC seem to have contact with the electronegative area in FVa formed by residues Asp513, Asp578 and Asp577 APC could also interact with FVa residues Asp659-Asp 660 -Asp 661 -Glu 662 -Asp 663 , but these ... APC– FVa complex, we observed that heparin clashes against FVa and/or could be very close to negatively charged FVa residues Asp513, Asp578 and Asp577 and/or Asp659-Asp 660 -Asp 661 -Glu 662 -Asp 663 ...
  • 13
  • 654
  • 0
Tài liệu Báo cáo khoa học: The distinct nucleotide binding states of the transporter associated with antigen processing (TAP) are regulated by the nonhomologous C-terminal tails of TAP1 and TAP2 ppt

Tài liệu Báo cáo khoa học: The distinct nucleotide binding states of the transporter associated with antigen processing (TAP) are regulated by the nonhomologous C-terminal tails of TAP1 and TAP2 ppt

Báo cáo khoa học

... with site-directed mutagenesis Therefore, we used the complementary primers 5¢-GGATGAGGCTACCAGTGC TC TGGACGCCTAG TGCGAGCAGGC-3¢ and 5¢-GCCTGCTCGCACTAGG CGTCCAGAGCACTGGTAGCCTCATCC-3¢ All TAP constructs ... primers 5¢-GGATGAGGCTACCAGTGCCCT GGATGCTGGCAACC-3¢ and 5¢-GGTTGCCAGCATC CAGGGCACTGGTAGCCTCATCC-3¢ for 2V1 The resulting TAP constructs were cloned into the EcoRI site of pHbApr1neo [22] and sequenced ... site-directed mutagenesis was performed using the complementary primers for variant 1V2 5¢-GGACGATGCCACCAGTGCCCTG GACGCCGAGTGCG-3¢ and 5¢-CGCACTCGGCGTC CAGGGCACTGGTGGCATCGTCC-3¢ and complementary...
  • 16
  • 407
  • 0
Tài liệu Báo cáo Y học: The Fc receptor c-chain is necessary and sufficient to initiate signalling through glycoprotein VI in transfected cells by the snake C-type lectin, convulxin ppt

Tài liệu Báo cáo Y học: The Fc receptor c-chain is necessary and sufficient to initiate signalling through glycoprotein VI in transfected cells by the snake C-type lectin, convulxin ppt

Báo cáo khoa học

... As GPVI is noncovalently and constitutively associated with FcR c- chain in platelets [2], COS-7 cells were also cotransfected with the different constructs of GPVI and FcR c- chain Cotransfection ... FcR c- chain and the cytoplasmic tail of GPVI are necessary to initiate the GPVI signalling cascade (A) K 562 cells stably transfected with FcR c- chain and cotransfected with empty vector (pRc /c) , ... and detected by ligand blotting as a band of  55 kDa Additional bands of lower molecular mass are indicated The associated FcR c- chain was detected by Western blotting using a speci c antibody...
  • 10
  • 506
  • 0
Báo cáo khoa học: Plant oxylipins: Plant responses to 12-oxo-phytodienoic acid are governed by its specific structural and functional properties ppt

Báo cáo khoa học: Plant oxylipins: Plant responses to 12-oxo-phytodienoic acid are governed by its specific structural and functional properties ppt

Báo cáo khoa học

... Schematic representation of stress-induced processes mediated by reactive electrophilic species, such as phytoprostanes and OPDA, and jasmonic acid as well as by its bioactive amino acid conjugate, ... these studies, JA levels remained below the detection limit after mechanical stimulation Thus, OPDA can be considered as an endogenous signal transducer of Br dioica and P vulgaris mechanotransduction ... processes mediated by OPDA Several physiological processes are known to be likewise stimulated by overlapping activities of OPDA and JA In addition, OPDA has been described in JA-independent responses...
  • 12
  • 416
  • 0
Báo cáo khoa học: Parkin deficiency disrupts calcium homeostasis by modulating phospholipase C signalling pdf

Báo cáo khoa học: Parkin deficiency disrupts calcium homeostasis by modulating phospholipase C signalling pdf

Báo cáo khoa học

... mutants show enhanced PLCc1 activity and consequently increased basal levels of PI hydrolysis and disturbances in PLC-mediated Ca2 + homeostasis We have also demonstrated that the increased [Ca2 +]i ... increase cytosolic Ca2 +, which is associated with mitochondrial impairment [38] Ca2 + is a powerful secondary messenger which, when present in excess, activates degrading caspases and calpains which disrupt ... disrupt cytoskeletal proteins, membrane receptors and metabolic enzymes [39,40] Furthermore, disrupted Ca2 + homeostasis causes oxidative stress [41,42] and induces apoptosis by mechanisms that...
  • 12
  • 312
  • 0
Báo cáo khoa học: Hydroperoxide reduction by thioredoxin-specific glutathione peroxidase isoenzymes of Arabidopsis thaliana potx

Báo cáo khoa học: Hydroperoxide reduction by thioredoxin-specific glutathione peroxidase isoenzymes of Arabidopsis thaliana potx

Báo cáo khoa học

... (CATATGGGTGCTTCATCATCAT ⁄ GGATCCCTGTG CGTGTTCACAA) and AtGPX6 (CATATGGCAGC AGAGAAGTCTG ⁄ GGATCCAGTTATCCAGATTGAA) without transit peptides or Trx h2 (CATATGGGA GGAGCTTTATC ⁄ GGATCCGCGTTAACAATGCTCA) ... microorganisms such as Synechocystis PCC 68 03, Saccharomyces cerevisiae and Plasmodium falciparum have also been found to utilize other physiological electron donors, such as NADPH or Trx, for the reduction ... template according to the manufacturer s protocol Full-length cDNAs encoding mature AtGPX1 (CAT ATGGCTGCAGAAAAAACCG ⁄ GGATCCTTTAAGCG GCAAGCAA), AtGPX2 (CATATGGCGGATGAATC TCCAA ⁄ GGATCCTCCTCCTCCTGGTGAT),...
  • 9
  • 414
  • 0
Báo cáo khoa học: Unique ganglioside binding by botulinum neurotoxins C and D-SA pdf

Báo cáo khoa học: Unique ganglioside binding by botulinum neurotoxins C and D-SA pdf

Báo cáo khoa học

... Lys224 expanded LC ⁄ E substrate specificity, whereby LC ⁄ E(K22 4D) cleaved endogenous synaptosomal-associated protein of 23 kDa in HeLa cells and effectively reduced tumor necrosis factor-a-induced ... HCR ⁄ C or HCR ⁄ D vaccination to completely protect against challenge by BoNT ⁄ D- SA [ 56] Structures of HCRs of BoNT ⁄ C, BoNT ⁄ D, and BoNT ⁄ D- SA The crystal structures of HCR ⁄ C, HCR ⁄ D ... binds GT1b and SV2 simultaneously Step 4: complexes of synaptic vesicle proteins are endocytosed to be recycled Step 5: the vATPase acidifies the lumen of the synaptic vesicle Step 6: the acidic...
  • 11
  • 360
  • 0
báo cáo hóa học:

báo cáo hóa học:" ApoG2 induces cell cycle arrest of nasopharyngeal carcinoma cells by suppressing the c-Myc signaling pathway" pot

Hóa học - Dầu khí

... and cMyc siRNA The three independent oligonucleotides designed for the c- Myc siRNA sequences were 5'CAGAAATGTCCTGAGCAAT-3', 5'-AAGGTCAGAGTCTGGATCACC-3', and 5'-AAGGACTATCCTGCTGCCAAG3' The siRNA ... experiments (D) Analysis of cell cycle distributions showed that, compared to srambled siRNA, c- Myc siRNA induced a conspicuous increasing of cells in S phase in CNE-2 cells at 48 h Bar heights, average ... induces cell cycle arrest in prostate cancer cells and colon cancer cells [8,9] To determine whether ApoG2 could also induce cell cycle arrest in NPC cells, we performed a cell cycle analysis...
  • 11
  • 386
  • 1
Báo cáo hóa học:

Báo cáo hóa học: " Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes" ppt

Hóa học - Dầu khí

... genomic segments of C/ JHB/1 /66 virus Segment 3' end non coding sequencea PB2 PB1 P3 HEF NP M NS UCGUCUUCGUCUCCUAACCUU(UAC) UCGUCUUCGUCUCCUAA(UAC) UCGUCUUCGUCCCCUAGGCUU(UAC) UCGUCUUCGUCCCCCAAUUAU(UAC) ... AGCAGUAGCAAGAGGAUUUUUUCAUUUAAUGGAAUAACAAAAAUAUGUGCAAGUAGGAGGAAAGGGUUUAACAG CCCCUCC(UCA) AGCAGUAGCAAGGGGAUUUUUUCUUAUAAUGA(UCA) AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA ... mu AGCAGUAGCAAGAGGAUUUUUA AGCAGUAGCAAGAGGAUUUUUUA AGCAGUAGCAAGAGGAUUUUUAGUUAGACAUCUUUAUCUUUUUCACAUUCUUAUUUACAUCGCUUGAUGC A GCCCUUUGUGAGGCUUA AGCAGUAGCAAGAGGAUUUUUAGUUAGACAUCUUUUA AGCAGUAGCAAGAGGAUUUUUAGUUAGACUUA...
  • 11
  • 427
  • 0
Giáo án Tiếng anh lớp 6 - Unit 4 BIG or SMALL? (C 1-3 ) pps

Giáo án Tiếng anh lớp 6 - Unit 4 BIG or SMALL? (C 1-3 ) pps

Anh ngữ phổ thông

... the activities - get dressed -? -? - Introduce Ba by using pictures -? - Give some activites What does Ba every morning? -? - Have the Ss listen and tick what - ? you hear - II Practice: - Listen ... and order: a go to school 5’ - Have the Ss listen and order b have breakfast 5’ c get up d get dressed e wash my face - Give the correct answers f brush my teeth Listen and repeat: Note: - Ask ... vocabulary - have breakfast : ăn điểm tâm - go to school : h c - Have the Ss practice vocab - Control practice rub remember or slap the board out 5' Activities in the morning - get up - Have the Ss give...
  • 4
  • 1,550
  • 11
TIN HỌC ĐẠI CƯƠNG - Bài 6: Tổng quan về ngôn ngữ C pdf

TIN HỌC ĐẠI CƯƠNG - Bài 6: Tổng quan về ngôn ngữ C pdf

Kỹ thuật lập trình

... Nội dung 6. 1 Lịch s phát triển 6. 2 C c phần tử ngôn ngữ C 6. 3 C u tr c chƣơng tr nh C 6. 4 Biên d ch chƣơng tr nh C 6. 5 Tr nh biên d ch Turbo C+ + 39 6. 4 Biên d ch chƣơng tr nh C • Preprocessor ... – Chú thích nhiều d ng: s d ng « /* » « */ » 31 Nội dung 6. 1 Lịch s phát triển 6. 2 C c phần tử ngôn ngữ C 6. 3 C u tr c chƣơng tr nh C 6. 4 Biên d ch chƣơng tr nh C 6. 5 Tr nh biên d ch Turbo C+ + ... Lịch s phát triển 6. 2 C c phần tử ngôn ngữ C 6. 3 C u tr c chƣơng tr nh C 6. 4 Biên d ch chƣơng tr nh C 6. 5 Tr nh biên d ch Turbo C+ + Ví d #include #include void main(){ printf(“Hello...
  • 25
  • 580
  • 0
bài 6 cộng trừ đa thức

bài 6 cộng trừ đa thức

Toán học

... quy tă c d ́u ngoă c - Ca c khái niện về đơn thư c, đa thư c, bâ c của đa thư c, c ̣ng , tr ̀ ca c đơn thư c đồng dạng -làm ca c bài tập 34 , 35, 36 (sgk – 40) giờ sau luyện tập ... tă c bỏ d ́u ngoă c Bươ c 3: áp dụng tính chất giao hoán và kết hợp Bươ c 4: c ̣ng, tr ̀ ca c đơn thư c đồng dạng Bươ c 5: trả lời kết quả cuối cùng là tổng hay hiệu của hai ... , vận dụng: Muốn c ̣ng hay tr ̀ hai đa thư c ta làm thế nào? Nhận xét: để c ̣ng hay tr ̀ hai đa thư c ta thư c hiện theo ca c bươ c sau: Bươ c 1: đặt phép tính Bươ c 2: áp dụng...
  • 5
  • 257
  • 0
[Toán Học Cao Cấp] Rút - Tối Ưu Phương Trình Phần 6 pot

[Toán Học Cao Cấp] Rút - Tối Ưu Phương Trình Phần 6 pot

Toán học

... C c tính chất tập lồi Cho tập lồi S1 , S2 ⊂ Rn Khi đó: 1) S1 ∩ S2 tập lồi 2) S1 + S2 = {x: x = x1+ x2 với x1 S1 , x2 ∈ S2 } tập lồi 3) S1 – S2 tập lồi Chứng minh Chúng ta chứng minh tính chất chẳng ... toàn c c C c phương pháp giải BTQHPT toàn c c phân thành hai lớp: phương pháp tất định (deterministic methods) phương pháp ngẫu nhiên (stochastic methods) Phương pháp tất định s d ng tính chất ... hướng sau: Do x ∈ S1 + S2 nên x = x1 + x2 với x1 ∈ S1 , x2 ∈ S2 ; y ∈ S1 + S2 nên y = y1 + y2 với y1 ∈ S1 , y2 ∈ S2 D d ng chứng minh ∀ λ ∈ [0, 1] λ x + (1– λ)y ∈ S1 + S2 Định nghĩa Cho tập lồi khác...
  • 19
  • 445
  • 0
Các Quá Trình Và Thiết Bị Công Nghệ Sinh Học Trong Công Nghiệp [Chương 6: Thiết Bị Tiệt Trùng Các Môi Trường Dinh Dưỡng] ppsx

Các Quá Trình Và Thiết Bị Công Nghệ Sinh Học Trong Công Nghiệp [Chương 6: Thiết Bị Tiệt Trùng Các Môi Trường Dinh Dưỡng] ppsx

Điện - Điện tử

... chụng chuøn dc theo bäü pháûn tr n ca thiãút bë, mäi tr åìng âỉå c tiãût trng chuøn d ch liãn t c Âà c âiãøm ca mỉ c tr n l s û c màût ca c c cạnh hm bäø sung âỉå c làõp chàût vo tr c vêt, c ï ... tiãút diãûn ngang ca thiãút bë, cn bãư màût tr n ca c nh tảo thnh màût nghiãng âãø cho mäi tr åìng d ù chuøn d ch Do âọ c c cạnh c s c cn chênh diãûn nh v mäi tr åìng khäng bë nẹn Bỉå c ca c c cạnh ... giỉỵa c c cạnh v thnh tỉåìng ca thiãút bë, phủ th c vo c c cháút hoạ l ca c c cáúu tỉí v thnh pháưn ca mäi tr åìng C c tr c quay theo c c hỉåïng kh c lm cho mäi tr åìng chuøn âo liãn t c nhỉỵng...
  • 19
  • 221
  • 0
Báo cáo y học:

Báo cáo y học: "Induction of p38- and gC1qR-dependent IL-8 expression in pulmonary fibroblasts by soluble hepatitis C core protein" pptx

Báo cáo khoa học

... expression was assayed by ELISA as described above expression was assayed by ELISA (figure 6B) As in our previous experiments, HCV core induced IL-8 expression, and this was not affected by addition ... reactions and helped draft the manuscript DCP completed all immunofluorescence studies SAL carried out experiments involving TNFα including immunoassays DSC participated in study design and data ... treatment with β-galactosidase (β-gal) or βgalactosidase-HCV core protein (Core) at the indicated concentrations and incubated for 24 h Lysates were harvested, RNA isolated and reverse transcribed,...
  • 11
  • 262
  • 0
Anh văn 6 Unit 7: Your house (C1 ,C 2 ,C3) docx

Anh văn 6 Unit 7: Your house (C1 ,C 2 ,C3) docx

Kỹ năng nói tiếng Anh

... Activity 1: Picture drill - Teacher provides picture cards - Students make sentences using the pictures Eg: Lan goes to school by bike TiÕt - Unit 7: Your house (C1 , C2 , C3 ) Activity 2: Subsitution ... 2: Subsitution drill S1 : How does [Lien] go to school? S2 : She goes by [bike] Activity 3: Noughts and crosses S1 : How does [Mrs Dung] go to work? S2 : She goes by [motorbike] Mrs Dung Lien Mr Ba ... Mrs Lan TiÕt - Unit 7: Your house (C1 , C2 , C3 ) Mr Hai Tuan Miss Hoa BÀI TẬP TR C NGHIỆM Choose a correct word, a correct phrase: ( How/ What ) you often go to school? - I often go to school by...
  • 4
  • 2,906
  • 2
giáo án dạy 2 buổi lớp 6 bồi dưỡng học sinh môn toán

giáo án dạy 2 buổi lớp 6 bồi dưỡng học sinh môn toán

Toán học

... nghìn c c ch chọn - C n c ch chọn - Chữ s hàng tr m c c ch chọn - Chữ s hàng vạn c - Chữ s hàng ch cc ch chọn c ch chọn không - Chữ s hàng đơn vị c c ch chọn thể chọn chữ s Vậy c tất ... 120 (s ) + Tr ng hợp c chữ s - Chữ s hàng vạn c c ch chọn - Chữ s hàng nghìn c c ch chọn - Chữ s hàng tr m c c ch chọn - Chữ s hàng ch cc ch chọn - Chữ s hàng đơn vị c c ch chọn ... C u Trong phép chia c d A S d lớn s chia B S d nhỏ s chia C S d s chia D S d nhỏ s chia C u Tổng a+b +c không chia hết cho A C s hạng tổng chia hết cho 6, s hạng lại không chia hết cho...
  • 52
  • 858
  • 4

Xem thêm