... rate for Belgium, Sweden andthe US, anda three-month commercial paper rate for Australia, Canada and Japan.13 All interest rates are from the OECD's MEI For Finland and Denmark missing data ... (2004), “Asset Prices, Monetary Policy and Financial Stability: A Central Banker's View,” Speech given at the American Economic Association Annual Meeting, San Diego, available at www.bankofengland.co.uk/publications/speeches/ ... Belgium, Canada, Denmark, Finland, France, Germany, Ireland, Italy, Japan, the Netherlands, Norway, Spain, Sweden, Switzerland, the UK andthe US The sample starts in 1986 in order to avoid the more...
... bands of oxyheme appeared at 540 and 579 nm Then, a broad band appeared at around 660 nm, and was maximal 9–12 after initiation ofthe reaction The spectral features ofthe final reaction mixture ... absorption bands Heme catabolism by HOs of mammals, pathogenic bacteria, cyanobacteria and probably insects is considered to have a similar mechanism, because the characteristic absorption bands of ... CO–verdoheme The 637 nm band disappeared gradually and was replaced by a new broad band with a maximum at approximately 675 nm, identical to the absorption band of free biliverdin The heme–GmHO-1 reaction...
... became available, and will enable more detailed analysis ofthe exact reaction mechanisms The tyrosinase structure, wherein the active site was located at the bottom ofa large vacant space and ... oxidizes aromatic amines and o-aminophenols, structural analogs of monophenols and ortho-diphenols Similar catalytic reactions, ortho hydroxylation and oxidation, took place, although the reaction rates ... with the following primers: forward, GGG GAC AAG TTT GTA CAA AAA AGC AGG CTA TCA TGC TGT TGT CAG GTC CCT CTC G; and reverse, GGG GAC CAC TTT GTA CAA GAA AGC TGG GTC AGT GGT GGT GGT GGT GGT GCA GAG...
... Circular Dichroism Principles and Applications VCH Publishers, Weinheim 13 Carra JH, Anderson EA & Privalov PL (1994) Threestate thermodynamic analysis ofthe denaturation of staphylococcal nuclease ... staphylococcal nuclease Proteins: Structure, Function and Genetics 27, 171–183 Flanagan JM, Kataoka M, Fujisawa T & Engelman DM (1993) Mutations can cause large changes in the conformation ofa ... is partially supported by a grant (NSC92-2311-B-001) from the National Science Council, Taiwan, R.O.C andthe theme project of Academia Sinica, Taipei, Taiwan, R.O.C 3965 Staphylococcal nuclease...
... andcharacterization Nippon Suisan Gokkaishi 48, 1427 48 Kamiya, H., Muramoto, K & Goto, R (1987) Isolation andcharacterizationof agglutinins from the hemolymph of acorn barnacle, Megabalanus ... O-acetylation of sialic acid may change with transformation or other alteration in the environment ofthe cell [63] The normal human tissues contain NeuAc, while malignant tumour cells contain ... and stored at )20 °C The elution profile (Fig 1) anda summary of purification (Table 1) give an overall view onthe lectin purification Erythrocyte preparation Blood for HA assay was prepared as...
... 1.994, and 1.951 The resonance started to develop at potentials ‡ mV and was stable at potentials up to +350 mV The loss and formation ofthe resonance was associated with a one-electron redox ... by Archaeoglobus fulgidus via the carbon monoxide dehydrogenase pathway: demonstration ofthe acetylCoA carbon-carbon cleavage reaction in cell extracts Arch Microbiol 153, 215–218 1904 G J Mander ... electrically connected to the enzymes of sulfate reduction, namely adenosine 5¢-phosphosulfate reductase and sulfite reductase Here we report onthe isolation andcharacterizationofa heme-containing...
... 5¢-CCGTAAGGTCACAGGTCACTCG-3¢, DR2: 5¢-CCGTAAGGTCACAAGGTCACTCG-3¢, DR3: 5¢-CCG TAAGGTCACAGAGGTCACTCG-3¢, DR4: 5¢-CCGTAA GGTCACAGGAGGTCACTCG-3¢, DR5: 5¢-CCGTAAGG TCACCAGGAGGTCACTCG-3¢ PAL0: 5¢-CGCAAGGT ... PCR amplification with TOPO 2.1-SmNR1 as a template (forward primer: 5¢-ATTTCAGAAGTTGAAC AAACACAC-3¢, reverse primer: 5¢-AAGATGGTATT GAAGATGATGGTTGA-3¢), purified from agarose gel using Gel Extraction ... one and two-hybrid assays (A) Yeast one hybrid assay showing that SmNR1 contains an autonomous transactivation function in A ⁄ B domain Individual AH109 yeast colonies obtained from an initial...
... developmental cycle: early, middle and late substrate colonization stages (4, and 12 days); pinhead stage (day 14), button stage (day 18), egg stage (day 21), elongation stage (day 22) and mature stage ... min; then a final extension at 72 °C for 10 The primers for lac1 PLAC1F (5¢-AGCTTT CATTCCCAGTGATTG-3¢) and PLAC1R (5¢-AACGAG CTCAAGTACAAATGACT-3¢) were designed according to our cloned cDNA (GenBank ... primers The putative N-glycosylation site is boxed; *; stop codon The putative polyadenylation signals (TATAAA and CATAAA) are in white ona black background Ó FEBS 2003 Laccase gene from Volvariella...
... CoADR), and TG104 (5¢-CGCGCCATGGAAAAGAAAAAGGTA GTCATAA-3¢) and TG105 (5¢-CGCGGTCGACCTAGAA CTTCAAAACCCTGGC-3¢) for the P furiosus CoADR The N terminus ofthe CoADRs were based onthe presence and ... correlates well with the catalytic constant observed for the CoADR reaction Thermostability and thermoactivity ofthe CoADR phCoADR is stable for months at both )80 °C and )20 °C, and has half-lives ... acting as a CoADR This is only the second demonstrated CoA reductase activity, andthe first appearance of this activity in both the Archaea and in a strict anaerobe While the best known small molecular...
... calculated based onthe description of Privalov and Potekhin [6] residue substitution onthe destabilization of secondary structure that leads to the large perturbation ofthestabilityofthe ... located in the domain among E75, K9, Y93 and H121 An area formed by these interactions can be imagined as a ‘hand’ clamped tightly around the ‘neck’ ofthe whole protein This clamped area was first ... acidic amino acids in staphylococcal nuclease fragments that dynamically vary their conformation and relative distances For SNase pH denaturation, the Di states (scheme shown above) can be considered...
... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... PP2500 and ANKHD1 variant In this study we focus onthe biochemical and functional characterizationofthe novel VBARP-L and VBARP-S transcripts Bioinformatics analyses show that VBARP-L and VBARP-S ... C Fig (A) Schematic representation of VBARP-L and VBARP-S in comparison with ANKHD1 variant (B) Exon–intron analysis of VBARP isoforms Exons and introns present in VBARP-L and VBARP-S are represented...
... Tipton VJ (1968) Review of Haemaphysalis (Kaiseriana) longicornis Neumann (resurrected) of Australia, New Zealand, New Caledonia, Fiji, Japan, Korea, and Northeastern China and USSR, and its parthenogenetic ... Ticks Adults of H longicornis obtained from the parthenogenetic Okayama strain maintained at the Laboratory of Parasitic Diseases, National Institute of Animal Health (Tsukuba, Ibaraki, Japan), ... has a wide geographical distribution in Russia, eastern Asia, Australia, and New Zealand, and has the potential to transmit pathogens including viruses, rickettsia and protozoan parasites that...
... butane2,3-diol as substrate in the standard oxidation reaction and acetoin in the reduction reaction The activity of Pf-TDH was significantly increased by the addition of mm CoCl2 (relative activity ... Journal compilation ª 2006 FEBS R Machielsen and J van der Oost 14 Higashi N, Matsuura T, Nakagawa A & Ishikawa K (2005) Crystallization and preliminary X-ray analysis of hyperthermophilic l-threonine ... bp) was PCR amplified from chromosomal DNA of P furiosus using the primers BG1279 (5¢-GCGCG CCATGGCATCCGAGAAGATGGTTGCTATCA, sense) and BG1297 (5¢-GCGCGGGATCCTCATTTAAGCAT GAAAACAACTTTGCC, antisense),...
... in stability can be explained by the sequence variations between Aspf1 and a- sarcin, and also by the loss ofa region ofthe protein in the deletion mutant [10,16] Taking into account all of these ... a preparation ofA fumigatus mRNA obtained as described [22] The primers used were: Nt-Aspf1 (5¢-GTCGTCTTGCGGTCACCT GGACATGCATCAACGAACAG-3¢) and Ct-Aspf1 (5¢-GT CGTCTTGGATCCTCTCGAGTCTCAATGAGAACACA ... infections [12] Among them, allergic inhalant diseases are common within the population and bronchopulmonary aspergillosis (ABPA) is the most severe form ABPA has a prevalence of 1–2% in patients with...
... conditions Analysis ofthe products ofthe reaction revealed the presence of guaiacylglycerol (GG) and 4MU (data not shown) Localization of enzymatic activity To confirm the localization ofthe ... indicated that the b-aryl ether cleavage enzyme accumulated and was stable in the extracellular fraction The extracellular fraction of 2BW-1 generated abundant GG and 4MU from GOU by cleaving the ... addition, we found the radiolabeled oxygen at the Ca and Cb positions in a comparison ofthe mass spectrum with that ofthe products ofthe reaction with GG and unlabeled water The incorporation of...
... identification and structural analysis ofa Sial-lNnT unit in H influenzae LPS MATERIALS AND METHODS Bacterial strains and culture conditions The H influenzae strain RM118 (Rd) is derived from the same ... double mutant in order to obtain further information onthe nature ofthe sialylated glycoforms Comparison ofthe total ion electropherogram in negative ion mode (Fig 3A) and selective ion scanning ... Integration ofthe H-3 H-resonances ofthe sialic acid residue indicated that the sialylated glycoform was present at levels of 10% ofthe total LPS glycoform population Higher percentages were anticipated...
... several stages of reorganization in which chromatin density and pattern of distribution change on several occasions In the last stage, there is actually a decrease in density of nuclear material [16] ... mining and reconstruction of putative ACEs from other crustacean species, namely ESTs from C maenas and H americanus, andthe whole D pulex genome, indicate the presence ofa similar transmembrane ... Lepidoptera, the treatment of adults with the ACE inhibitor, captopril, causes a decrease in egg-laying [9] In Haematobia irritans exigua, ablood meal initiates the strong synthesis of ACE in the...
... Jacobs JW & Condra C (1993) An inhibitor of collagen-stimulated platelet activation from the salivary glands ofthe Haementetia of cinalis leech I Identification, isolation, andcharacterization ... platelets was calculated onthe basis ofa standard curve obtained with known numbers of platelets Identification andcharacterizationof triplatin Platelet lysis and immunoprecipitation of FcR c-chains ... investigate precisely the effect of triplatin-1 and -2 on platelet aggregation caused by collagen, an inhi- Identification andcharacterizationof triplatin bition assay was performed using washed platelets...
... localization ofthe region containing the c19orf10 c19orf10 gene is indicated onthe ideogram The area containing the c19orf10 gene is expanded andthe base-pair positions are indicated The location of ... may contribute to the maintenance of synovial inflammation, aggravating the destruction of cartilage and bone and stimulating the development ofthe pannus Because FLSs can exhibit significant ... proliferation and differentiation, none of these studies has revealed any functional information about the molecule We undertook thecharacterizationof c19orf10 in the synovium because it is a quantitatively...