characterization of film stability blood compatibility and the impact of a membranemimetic film on barrier permeability
Ensuring Financial Stability: Financial Structure and the Impact of Monetary Policy on Asset Prices
... rate for Belgium, Sweden and the US, and a three-month commercial paper rate for Australia, Canada and Japan.13 All interest rates are from the OECD's MEI For Finland and Denmark missing data ... (2004), “Asset Prices, Monetary Policy and Financial Stability: A Central Banker's View,” Speech given at the American Economic Association Annual Meeting, San Diego, available at www.bankofengland.co.uk/publications/speeches/ ... Belgium, Canada, Denmark, Finland, France, Germany, Ireland, Italy, Japan, the Netherlands, Norway, Spain, Sweden, Switzerland, the UK and the US The sample starts in 1986 in order to avoid the more...
- 35
- 793
- 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx
... bands of oxyheme appeared at 540 and 579 nm Then, a broad band appeared at around 660 nm, and was maximal 9–12 after initiation of the reaction The spectral features of the final reaction mixture ... absorption bands Heme catabolism by HOs of mammals, pathogenic bacteria, cyanobacteria and probably insects is considered to have a similar mechanism, because the characteristic absorption bands of ... CO–verdoheme The 637 nm band disappeared gradually and was replaced by a new broad band with a maximum at approximately 675 nm, identical to the absorption band of free biliverdin The heme–GmHO-1 reaction...
- 16
- 617
- 0
Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt
... became available, and will enable more detailed analysis of the exact reaction mechanisms The tyrosinase structure, wherein the active site was located at the bottom of a large vacant space and ... oxidizes aromatic amines and o-aminophenols, structural analogs of monophenols and ortho-diphenols Similar catalytic reactions, ortho hydroxylation and oxidation, took place, although the reaction rates ... with the following primers: forward, GGG GAC AAG TTT GTA CAA AAA AGC AGG CTA TCA TGC TGT TGT CAG GTC CCT CTC G; and reverse, GGG GAC CAC TTT GTA CAA GAA AGC TGG GTC AGT GGT GGT GGT GGT GGT GCA GAG...
- 14
- 650
- 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf
... Circular Dichroism Principles and Applications VCH Publishers, Weinheim 13 Carra JH, Anderson EA & Privalov PL (1994) Threestate thermodynamic analysis of the denaturation of staphylococcal nuclease ... staphylococcal nuclease Proteins: Structure, Function and Genetics 27, 171–183 Flanagan JM, Kataoka M, Fujisawa T & Engelman DM (1993) Mutations can cause large changes in the conformation of a ... is partially supported by a grant (NSC92-2311-B-001) from the National Science Council, Taiwan, R.O.C and the theme project of Academia Sinica, Taipei, Taiwan, R.O.C 3965 Staphylococcal nuclease...
- 7
- 551
- 0
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf
... and characterization Nippon Suisan Gokkaishi 48, 1427 48 Kamiya, H., Muramoto, K & Goto, R (1987) Isolation and characterization of agglutinins from the hemolymph of acorn barnacle, Megabalanus ... O-acetylation of sialic acid may change with transformation or other alteration in the environment of the cell [63] The normal human tissues contain NeuAc, while malignant tumour cells contain ... and stored at )20 °C The elution profile (Fig 1) and a summary of purification (Table 1) give an overall view on the lectin purification Erythrocyte preparation Blood for HA assay was prepared as...
- 8
- 616
- 0
Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf
... 1.994, and 1.951 The resonance started to develop at potentials ‡ mV and was stable at potentials up to +350 mV The loss and formation of the resonance was associated with a one-electron redox ... by Archaeoglobus fulgidus via the carbon monoxide dehydrogenase pathway: demonstration of the acetylCoA carbon-carbon cleavage reaction in cell extracts Arch Microbiol 153, 215–218 1904 G J Mander ... electrically connected to the enzymes of sulfate reduction, namely adenosine 5¢-phosphosulfate reductase and sulfite reductase Here we report on the isolation and characterization of a heme-containing...
- 10
- 564
- 0
Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot
... 5¢-CCGTAAGGTCACAGGTCACTCG-3¢, DR2: 5¢-CCGTAAGGTCACAAGGTCACTCG-3¢, DR3: 5¢-CCG TAAGGTCACAGAGGTCACTCG-3¢, DR4: 5¢-CCGTAA GGTCACAGGAGGTCACTCG-3¢, DR5: 5¢-CCGTAAGG TCACCAGGAGGTCACTCG-3¢ PAL0: 5¢-CGCAAGGT ... PCR amplification with TOPO 2.1-SmNR1 as a template (forward primer: 5¢-ATTTCAGAAGTTGAAC AAACACAC-3¢, reverse primer: 5¢-AAGATGGTATT GAAGATGATGGTTGA-3¢), purified from agarose gel using Gel Extraction ... one and two-hybrid assays (A) Yeast one hybrid assay showing that SmNR1 contains an autonomous transactivation function in A ⁄ B domain Individual AH109 yeast colonies obtained from an initial...
- 16
- 542
- 0
Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx
... developmental cycle: early, middle and late substrate colonization stages (4, and 12 days); pinhead stage (day 14), button stage (day 18), egg stage (day 21), elongation stage (day 22) and mature stage ... min; then a final extension at 72 °C for 10 The primers for lac1 PLAC1F (5¢-AGCTTT CATTCCCAGTGATTG-3¢) and PLAC1R (5¢-AACGAG CTCAAGTACAAATGACT-3¢) were designed according to our cloned cDNA (GenBank ... primers The putative N-glycosylation site is boxed; *; stop codon The putative polyadenylation signals (TATAAA and CATAAA) are in white on a black background Ó FEBS 2003 Laccase gene from Volvariella...
- 11
- 703
- 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
... CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 1870 Fig Nucleotide and deduced amino acid sequence of two ... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_1:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC CLAP_2:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC...
- 12
- 772
- 0
Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc
... CoADR), and TG104 (5¢-CGCGCCATGGAAAAGAAAAAGGTA GTCATAA-3¢) and TG105 (5¢-CGCGGTCGACCTAGAA CTTCAAAACCCTGGC-3¢) for the P furiosus CoADR The N terminus of the CoADRs were based on the presence and ... correlates well with the catalytic constant observed for the CoADR reaction Thermostability and thermoactivity of the CoADR phCoADR is stable for months at both )80 °C and )20 °C, and has half-lives ... acting as a CoADR This is only the second demonstrated CoA reductase activity, and the first appearance of this activity in both the Archaea and in a strict anaerobe While the best known small molecular...
- 12
- 420
- 0
Báo cáo khoa học: Local stability identification and the role of key acidic amino acid residues in staphylococcal nuclease unfolding ppt
... calculated based on the description of Privalov and Potekhin [6] residue substitution on the destabilization of secondary structure that leads to the large perturbation of the stability of the ... located in the domain among E75, K9, Y93 and H121 An area formed by these interactions can be imagined as a ‘hand’ clamped tightly around the ‘neck’ of the whole protein This clamped area was first ... acidic amino acids in staphylococcal nuclease fragments that dynamically vary their conformation and relative distances For SNase pH denaturation, the Di states (scheme shown above) can be considered...
- 8
- 462
- 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... PP2500 and ANKHD1 variant In this study we focus on the biochemical and functional characterization of the novel VBARP-L and VBARP-S transcripts Bioinformatics analyses show that VBARP-L and VBARP-S ... C Fig (A) Schematic representation of VBARP-L and VBARP-S in comparison with ANKHD1 variant (B) Exon–intron analysis of VBARP isoforms Exons and introns present in VBARP-L and VBARP-S are represented...
- 12
- 561
- 0
Báo cáo khoa học: Molecular characterization of a blood-induced serine carboxypeptidase from the ixodid tick Haemaphysalis longicornis docx
... Tipton VJ (1968) Review of Haemaphysalis (Kaiseriana) longicornis Neumann (resurrected) of Australia, New Zealand, New Caledonia, Fiji, Japan, Korea, and Northeastern China and USSR, and its parthenogenetic ... Ticks Adults of H longicornis obtained from the parthenogenetic Okayama strain maintained at the Laboratory of Parasitic Diseases, National Institute of Animal Health (Tsukuba, Ibaraki, Japan), ... has a wide geographical distribution in Russia, eastern Asia, Australia, and New Zealand, and has the potential to transmit pathogens including viruses, rickettsia and protozoan parasites that...
- 14
- 432
- 0
Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx
... butane2,3-diol as substrate in the standard oxidation reaction and acetoin in the reduction reaction The activity of Pf-TDH was significantly increased by the addition of mm CoCl2 (relative activity ... Journal compilation ª 2006 FEBS R Machielsen and J van der Oost 14 Higashi N, Matsuura T, Nakagawa A & Ishikawa K (2005) Crystallization and preliminary X-ray analysis of hyperthermophilic l-threonine ... bp) was PCR amplified from chromosomal DNA of P furiosus using the primers BG1279 (5¢-GCGCG CCATGGCATCCGAGAAGATGGTTGCTATCA, sense) and BG1297 (5¢-GCGCGGGATCCTCATTTAAGCAT GAAAACAACTTTGCC, antisense),...
- 8
- 415
- 0
Báo cáo khoa học: Production and characterization of a noncytotoxic deletion variant of the Aspergillus fumigatus allergen Aspf1 displaying reduced IgE binding ppt
... in stability can be explained by the sequence variations between Aspf1 and a- sarcin, and also by the loss of a region of the protein in the deletion mutant [10,16] Taking into account all of these ... a preparation of A fumigatus mRNA obtained as described [22] The primers used were: Nt-Aspf1 (5¢-GTCGTCTTGCGGTCACCT GGACATGCATCAACGAACAG-3¢) and Ct-Aspf1 (5¢-GT CGTCTTGGATCCTCTCGAGTCTCAATGAGAACACA ... infections [12] Among them, allergic inhalant diseases are common within the population and bronchopulmonary aspergillosis (ABPA) is the most severe form ABPA has a prevalence of 1–2% in patients with...
- 9
- 517
- 0
Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf
... conditions Analysis of the products of the reaction revealed the presence of guaiacylglycerol (GG) and 4MU (data not shown) Localization of enzymatic activity To confirm the localization of the ... indicated that the b-aryl ether cleavage enzyme accumulated and was stable in the extracellular fraction The extracellular fraction of 2BW-1 generated abundant GG and 4MU from GOU by cleaving the ... addition, we found the radiolabeled oxygen at the Ca and Cb positions in a comparison of the mass spectrum with that of the products of the reaction with GG and unlabeled water The incorporation of...
- 10
- 670
- 0
Báo cáo khoa học: Identification and structural characterization of a sialylated lacto-N-neotetraose structure in the lipopolysaccharide of Haemophilus influenzae pptx
... identification and structural analysis of a Sial-lNnT unit in H influenzae LPS MATERIALS AND METHODS Bacterial strains and culture conditions The H influenzae strain RM118 (Rd) is derived from the same ... double mutant in order to obtain further information on the nature of the sialylated glycoforms Comparison of the total ion electropherogram in negative ion mode (Fig 3A) and selective ion scanning ... Integration of the H-3 H-resonances of the sialic acid residue indicated that the sialylated glycoform was present at levels of 10% of the total LPS glycoform population Higher percentages were anticipated...
- 11
- 579
- 0
Báo cáo khoa học: Characterization of a membrane-bound angiotensin-converting enzyme isoform in crayfish testis and evidence for its release into the seminal fluid ppt
... several stages of reorganization in which chromatin density and pattern of distribution change on several occasions In the last stage, there is actually a decrease in density of nuclear material [16] ... mining and reconstruction of putative ACEs from other crustacean species, namely ESTs from C maenas and H americanus, and the whole D pulex genome, indicate the presence of a similar transmembrane ... Lepidoptera, the treatment of adults with the ACE inhibitor, captopril, causes a decrease in egg-laying [9] In Haematobia irritans exigua, a blood meal initiates the strong synthesis of ACE in the...
- 12
- 486
- 0
Báo cáo khoa học: Identification and characterization of a collagen-induced platelet aggregation inhibitor, triplatin, from salivary glands of the assassin bug, Triatoma infestans ppt
... Jacobs JW & Condra C (1993) An inhibitor of collagen-stimulated platelet activation from the salivary glands of the Haementetia of cinalis leech I Identification, isolation, and characterization ... platelets was calculated on the basis of a standard curve obtained with known numbers of platelets Identification and characterization of triplatin Platelet lysis and immunoprecipitation of FcR c-chains ... investigate precisely the effect of triplatin-1 and -2 on platelet aggregation caused by collagen, an inhi- Identification and characterization of triplatin bition assay was performed using washed platelets...
- 8
- 408
- 0
Báo cáo y học: "The identification and characterization of a novel protein, c19orf10, in the synovium" docx
... localization of the region containing the c19orf10 c19orf10 gene is indicated on the ideogram The area containing the c19orf10 gene is expanded and the base-pair positions are indicated The location of ... may contribute to the maintenance of synovial inflammation, aggravating the destruction of cartilage and bone and stimulating the development of the pannus Because FLSs can exhibit significant ... proliferation and differentiation, none of these studies has revealed any functional information about the molecule We undertook the characterization of c19orf10 in the synovium because it is a quantitatively...
- 9
- 489
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25