... automatic formula finding, a specific type of factorization is assumed: Ts = A1 A 2A3 A4 An (1) where the Ar are elementary transformations having the Wij as their arguments; they are called basic algorithms ... information that cannot initially be handled by the machine system This information can be automatically retrieved for processing at a later date These two rules also allow scholars and translators ... Automatic Language Translation, Doctoral Thesis, Harvard University (1959) Giuliano, V E., and Oettinger, A G., “Research in Automatic Translation at the Harvard Computation Laboratory,” to appear...
... IS -A hierarchy Similarly, CANADA:= { ) ‘CANADA’ ) } is -a COUNTRY makes CANADA a class with a single instance Presumably, COUNTRY has as instances many other strings such as ‘USA’, ‘CHINA’, and ... formatted classes For example, we can define the metaclass metaclass TRAVELER-TO-CANADA-CLASS is -a TEST-DEFINED-CLASS and then the transaction TRANSACTION-CLASS TEST-TRAVELER-TO-CANADA TRANSACTION ... specializes for aggregate classes to ((ANY-AGGREGATE, AGGREGATE-CLASS), test, TEST-AGGREGATE) where AGGREGATE is a specialization of ANY with all possible aggregates as instances Similarly, we have...
... hybridize to a DNA template, or that can be cleaved from adapter molecules (analogous to natural tRNAs) that hybridize to DNA Summary and Outlook DNA-templated synthesis has evolved dramatically over ... successive DNA-templated amine acylation reactions (Figure 11 a) and a branched thioether generated from an amine acylation–Wittig olefination–conjugate addition series of DNA-templated reactions ... polymerases may eventually enable DNA-templated polymerizations Reactions other than phosphodiester formation and amine acylation have also been used to effect DNA-templated oligomerization and...
... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... P54783; Candida albicans D-arabinono-1,4-lactone oxidase (ALO), O93852; Neurospora crassa, Q7SGY1; Gibberella zeae, XP_388870; Arabidopsis thaliana L-galactono-1,4-lactone dehydrogenase (GLDH), At3g47930; ... The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ascorbic acid in lower eukaryotes...
... Shatalov, 2001; and as summarized for example in Scheringer and Wania, 2003; OECD, 2002; and AMAP, 1999) Regional fate and transport models can aid in the analysis of the observational data generated ... needed in an appropriate way fora certain situation, quantitative objectives must be defined and information on expected variance must be available (see above) The standard formulas for calculating ... College Station, Texas, USA Dr David Stone, Indian and Northern Affairs Canada, Ottawa, Canada Professor Janneche Utne Skaare, National Veterinary Institute, Oslo, Norway The expert group has met...
... Federal Student Aid (FAFSA) If you plan on attending law school on or after July 1, you can apply for federal financial aid through the FAFSA form after January of the same calendar year Your financial ... FINANCIAL AID OPTIONS Apply early for all institutional aid from law schools SCHOLARSHIPS AND GRANTS A scholarship or grant is an award that does not have to be repaid It may be given on the basis ... information about the resources available Be aware that many scholarships and grants are merit-based and may require a certain level of academic performance for continuation Some schools award...
... this class of chemical substances a reasonable database exists that can be used for calibration Also, similar mechanisms for metabolic transformation may apply to this class of chemical substances ... the same parameters to tropical or arctic food webs Model calibration: To calibrate the model, a database was compiled of empirical BCF and BAF data fororganic chemicals in fish and aquatic ... unable to predict metabolic transformation rates of chemical substances in aquatic biota However, if information on metabolic transformation rates are available from laboratory bioconcentration...
... same period Christian Aid estimated that if tax was raised on this capital, China would have had an additional £20.2bn, Mexico would have had an additional £10.5bn and India would have had an ... ‘CrystalPalacegointoadministrationandfacepointspenalty’,The Guardian, 27January2010,www.guardian.co.uk/football/2010/jan/27/crystal-palaceadministration ‘ChampionshipsideCrystalPalacegointoadministration,’BBCOnline,27 ... significantsize(ArsenalandWatford) a weightedindexwas calculated Second,Lithuaniadidnothaveanindexvaluesoanaverage for the10EUlocationsrankedwascalculatedandused instead Thescorewasverysimilartothat for Latvia,which...
... crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere (Fig 12) Titania nanotubes prepared by the sonoelectrochemical method and annealed ... Mohapatra et al / Journal of Catalysis 246 (2007) 362–369 363 466 0A) After an initial increase-decrease transient, the current reached a steady-state value The anodized samples were properly washed ... in a nitrogen and oxygen atmosphere at 500 ◦ C for h in a CVD furnace at a heating rate of ◦ C/min The UAT samples annealed under these conditions are designated N2 -UAT and O2 -UAT The TiO2 nanotubes...
... the final temperature (for min); the temperature 2-CEPS was increased at rate of 20 oC/ for 13 Also, detector temperature was 230 oC Experimental Materials Synthesis of CaO nanoparticles catalyst ... decomposition applications of Co-Precipitation in the absence and presence nanosized metal oxides such as AP-MgO, AP- of Polyvinylpyrrolidone (PVP) as a capping CuO, AP-Fe2O3, AP-Al2O3 and AP-CaO [15 agent ... high surface area due to smaller particle and many non-aqueous solvents by adsorbing size and the reactive sites tailored in the form onto a broad range of materials, such as of edge and corner...
... information People come to understand data and data patterns as if they were a biological form The dynamic and life-like qualities of data are celebrated Systems allow information to form and ... in all shapes and sizes since 2007 indicates a fundamental change is afoot We’ve reached the edges of what graphical user interfaces can A natural evolution has started, and GUIs will be supplanted ... are information-based rather than tool oriented, a visual communication language that is hinged on arcane artifacts is no longer relevant The value of interfaces today is the information it wants...
... instructions, or ideas contained in the material herein Library of Congress Cataloging-in-Publication Data Gharajedaghi, Jamshid Systems thinking : managing chaos and complexity : a platform fordesigning ... dissimilar situation of an ancient eastern culture An apparent miracle happened What was originally thought of as a fundamentally disparate source of alien views on the nature of systems organization ... success an organization has with a particular technology, the higher its resistance to the prospect of change The initial reaction is always denial We have an amazing capacity for denial in the face...
... as: Zhao et al.: A general strategy forsynthesis of metal oxide nanoparticles attached on carbon nanomaterials Nanoscale Research Letters 2011 6:71 Submit your manuscript to a journal and benefit ... with inorganic nanomaterials: Preparations and applications Coord Chem Rev 2010, 254:1117, and the reference there in Banerjee S, Wong SS: Synthesis and Characterization of Carbon Nanotube-Nanocrystal ... electrochemical measurements and NPs on MWNTs Abbreviations CNMs: carbon nanomaterials; CNTs: carbon nanotubes; MWNTs: multi-walled carbon nanotubes; NPs: nanoparticles; SWNTs: single-walled carbon nanotubes;...
... can act as a central processor for hearing aids with access to binaural audio information and the advantage of increased processing performance [10] Based on such scalable systems, the integration ... lowdelay real-time signal processing systems based on standard hard- and software, such as the Master Hearing Aid (MHA) [11], a development framework for hearing aid algorithms Another hardware-related ... 5721783, February 1998 [11] G Grimm, T Herzke, D Berg, and V Hohmann, “The master hearing aid: a PC-based platform for algorithm development and evaluation,” Acta Acustica united with Acustica, vol...