Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase Beata A Wolucka1 and David Communi2 Laboratory of Mycobacterial Biochemistry, Pasteur Institute of Brussels, Institute of Public Health, Belgium Institute of Interdisciplinary Research, IRIBHM, Faculty of Medicine, Free University of Brussels, Belgium Keywords ascorbic acid; biosynthesis; L-gulonolactone oxidase; tuberculosis; vitamin C Correspondence B A Wolucka, Laboratory of Mycobacterial Biochemistry, Pasteur Institute of Brussels, 642 Engeland Street, B-1180 Brussels, Belgium Fax: +32 373 3282 Tel: +32 373 3100 E-mail: bwolucka@pasteur.be (Received 21 June 2006, accepted 31 July 2006) doi:10.1111/j.1742-4658.2006.05443.x The last step of the biosynthesis of l-ascorbic acid (vitamin C) in plants and animals is catalyzed by l-gulono-1,4-lactone oxidoreductases, which use both l-gulono-1,4-lactone and l-galactono-1,4-lactone as substrates l-Gulono-1,4-lactone oxidase is missing in scurvy-prone, vitamin C-deficient animals, such as humans and guinea pigs, which are also highly susceptible to tuberculosis A blast search using the rat l-gulono-1,4-lactone oxidase sequence revealed the presence of closely related orthologs in a limited number of bacterial species, including several pathogens of human lungs, such as Mycobacterium tuberculosis, Pseudomonas aeruginosa, Burkholderia cepacia and Bacillus anthracis The genome of M tuberculosis, the etiologic agent of tuberculosis, encodes a protein (Rv1771) that shows 32% identity with the rat l-gulono-1,4-lactone oxidase protein The Rv1771 gene was cloned and expressed in Escherichia coli, and the corresponding protein was affinity-purified and characterized The FAD-binding motif-containing Rv1771 protein is a metalloenzyme that oxidizes l-gulono-1,4-lactone (Km 5.5 mm) but not l-galactono-1,4-lactone The enzyme has a dehydrogenase activity and can use both cytochrome c (Km 4.7 lm) and phenazine methosulfate as exogenous electron acceptors Molecular oxygen does not serve as a substrate for the Rv1771 protein Dehydrogenase activity was measured in cellular extracts of a Mycobacterium bovis BCG strain In conclusion, M tuberculosis produces a novel, highly specific l-gulono-1,4-lactone dehydrogenase (Rv1771) and has the capacity to synthesize vitamin C Vitamin C (l-ascorbic acid; L-AA) is an important metabolite of plants and animals It functions as an antioxidant (or pro-oxidant), an enzyme cofactor, an effector of gene expression, and a modulator of reactive oxygen species (ROS)-mediated cell signaling L-AA is therefore involved in a wide array of crucial physiologic processes, including: biosynthesis of collagen and other hydroxyproline ⁄ hydroxylysine-containing proteins ⁄ peptides; synthesis of secondary metabolites, hormones and cytokines [1]; oxidative protein folding and endoplasmic reticulum stress [2]; cell proliferation and apoptosis [3]; activation of the epithelial cystic fibrosis transmembrane conductance regulator chloride channel [4] and of surfactant production in human lungs [5]; macrophage function [6]; immune homeostasis [5]; and stress resistance Plants synthesize ascorbic acid via de novo and salvage pathways [7], whereas a de novo pathway involving UDP-d-glucuronic acid operates in animals [8] l-Gulono-1,4-lactone is a direct precursor of vitamin C in animals [8], but also in plants [9] and in some protists [10] In plants, L-AA can be formed additionally from l-galactono-1,4-lactone by a highly specific mitochondrial dehydrogenase (EC 1.3.2.3) [11,12] The Abbreviations GST, glutathione-S-transferase; IPTG, isopropyl thio-b-D-galactoside; L-AA, L-ascorbic acid; MALDI Q-TOF, MALDI quadrupole TOF; ROS, reactive oxygen species FEBS Journal 273 (2006) 4435–4445 ª 2006 The Authors Journal compilation ª 2006 FEBS 4435 M tuberculosis L-gulono-1,4-lactone dehydrogenase B A Wolucka and D Communi oxidation of l-gulono-1,4-lactone to L-AA in animals is catalyzed by an oxygen-dependent enzyme, l-gulono-1,4-lactone oxidase (EC 1.1.3.8) [13] In plants [9] and in Euglena [10], the oxidation involves ill-defined l-gulono-1,4-lactone dehydrogenases that use cytochrome c and phenazine methosulfate respectively, as a direct electron acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ascorbic acid in lower eukaryotes Fungi not contain L-AA but rather its 5-carbon homolog, d-erythroascorbic acid [14] Two apparently different l-gulono-1,4-lactone oxidase activities were detected in yeasts One of the enzymes oxidizes l-galactono-1,4-lactone but not l-gulono-1,4-lactone [15] The other enzyme (ALO1) has a broader specificity and uses d-arabinono-1,4-lactone [16], l-galactono-1,4-lactone and l-gulono-1,4-lactone [17] as substrates d-Arabinono-1,4-lactone is a natural substrate in the pathway to d-erythroascorbic acid [14,18] Like yeasts, a protozoan parasite Trypanosoma brucei possesses a d-arabinono-1,4-lactone oxidase that can also oxidize l-galactono-1,4-lactone but not l-gulono-1,4-lactone [19] The sequence of the gene for rat l-gulono-1,4-lactone oxidase (GLO) is known [20] Several genes for putative l-gulono-1,4-lactone dehydrogenase isoenzymes have been identified in plants [9] The gene encoding the d-arabinono-1,4-lactone oxidase (ALO1) of yeasts [18] shows significant homology with the genes for both the rat l-gulono-1,4-lactone oxidase and the plant mitochondrial l-galactono-1,4-lactone dehydrogenase [12,20] Humans and some animals (including other primates and guinea pigs) are natural mutants for ascorbic acid synthesis because of the nonfunctional GLO gene for l-gulono-1,4-lactone oxidase [8] Consequently, they require vitamin C in the diet to prevent scurvy Little is known about the presence of vitamin C and related biosynthetic enzymes in bacteria Exogenous l-gulono-1,4-lactone can be converted to L-AA by unspecific, heteromeric dehydrogenases of Gluconobacter oxydans and of Acetobacter suboxydans [21], which are also active towards d-xylose and some hexoses Although interesting from a biotechnological point of view, these enzymes are not related to the known l-gulono-1,4-lactone oxidase proteins and their physiologic role is unknown Surprisingly, the genome of Mycobacterium tuberculosis, the causative agent of tuberculosis, encodes a protein (Rv1771) that is similar to the rat l-gulono1,4-lactone oxidase In the present work, we cloned and expressed the Rv1771 gene, and showed that it 4436 encodes a novel l-gulono-1,4-lactone dehydrogenase of the M tuberculosis complex Results Heterologous expression and purification of the recombinant L-gulono-1,4-lactone dehydrogenase (Rv1771) of M tuberculosis The Rv1771 DNA was cloned into the pDEST15 vector by using the Gateway system, and the obtained pDEST15_Rv1771 plasmid was used for expression of the recombinant glutathione-S-transferase (GST) fusion protein in Escherichia coli The recombinant protein contained an engineered enterokinase cleavage site in the junction between the GST tag and the Rv1771 sequence Upon h of induction of the pDEST15_Rv1771 E coli strain with isopropyl-b-dthiogalactopyranoside (IPTG) at 37 °C, the yield of the recombinant Rv1771 protein was very low (0.1 mg per liter of culture) Longer inductions (16 h) at a lower temperature (26 °C) resulted in complete loss of the recombinant protein, probably due to proteolytic degradation (results not shown) Similarly, omission of Triton X-100 from the extraction buffer resulted in lower yields of the recombinant Rv1771 protein, thus suggesting that the detergent helps solubilize the protein The affinity-purified protein was concentrated by using Strataclean resin, as described in Experimental procedures SDS ⁄ PAGE revealed the presence of one protein band of about 70 kDa (Fig 1, lane 2) The identity of the protein was confirmed by enterokinase treatment After digestion of the affinity-purified GSTtagged protein with enterokinase followed by concentration, the 70 kDa band disappeared, and two new bands of 45 and 26 kDa were seen on SDS ⁄ PAGE that corresponded to the mycobacterial Rv1771 protein and the freed GST tag, respectively (Fig 1, lane 3) The observed molecular masses for the GST-tagged and free forms of the l-gulono-1,4-lactone dehydrogenase were slightly lower than those expected (74 and 48 kDa, respectively), presumably because of either limited proteolysis or abnormal migration In contrast, shortening the induction time to h resulted in about 10 times higher yields of the recombinant Rv1771 protein (Fig 1, lane 4) However, under these conditions, the GST-affinity eluate contained the recombinant GST fusion protein (the identified tryptic peptides are ALGPQLAQR, LGLENQGDVDPQSITGATATATH GTGVR, FQNLSAR, SDEQPKPTPGWQR, FTEM EYAIPR, SLPIMFPIEVR, and FSAPDDSFLSTA YGR), which was accompanied by a host-derived Hsp60 chaperone protein (the identified tryptic peptide FEBS Journal 273 (2006) 4435–4445 ª 2006 The Authors Journal compilation ª 2006 FEBS M tuberculosis L-gulono-1,4-lactone dehydrogenase B A Wolucka and D Communi Rv1771 protein by using the pRSETc or the Gateway pDEST17 expression vectors were unsuccessful Characterization of the recombinant dehydrogenase of M tuberculosis L-gulono-1,4-lactone Fig Heterologous expression and purification of the recombinant L-gulono-1,4-lactone dehydrogenase (Rv1771) of M tuberculosis SDS ⁄ PAGE of the affinity-purified GST-tagged dehydrogenase (containing an engineered enterokinase cleavage site) obtained from the E coli host after long (3 h) (lanes and 3) and short (1 h) (lanes and 5) periods of induction with IPTG Fractions obtained with a long period of induction before (lane 2) and after (lane 3) enterokinase treatment were concentrated on Strataclean beads, as described in Experimental procedures Proteins were visualized by Coomassie blue staining (lanes 1–4) and by western analysis (lane 5) using anti-GST IgG Protein bands (lane 4) were identified by MALDI-TOF MS of tryptic in-gel digests Lane 1, molecular mass standards was AAVEEGVVAGGGVALIR), as determined by combined MALDI-TOF MS of trypsin-digested protein bands (Fig 1, lane 4; Fig 2) and western analysis with anti-GST IgG (Fig 1, lane 5) Copurification of the mycobacterial l-gulono-1,4-lactone dehydrogenase with the Hsp60 heat-shock protein might reflect physiologic protein–protein interactions, as proposed for the plant Hsc70.3 cognate heat-shock protein and another vitamin C-related enzyme, the GDP-mannose-3¢,5¢epimerase [9] The presence of multiple GST-containing bands of about 30 kDa (Fig 1, lane 5) suggests that an important portion of the fusion protein was degraded by the host proteases On the other hand, attempts to produce a His-tagged version of the The Rv1771 gene of M tuberculosis encodes a 428 amino acid protein (Fig 2) that shows 32% identity with the rat l-gulono-1,4-lactone oxidase and 22–24% identity with the putative plant l-gulono-1,4-lactone dehydrogenases At2g46740, At2g46750, At2g46760, At5g56490, At5g11540, and At1g32300 [9] The Mycobacterium bovis genome contains a sequence (Mb1800) identical to the M tuberculosis Rv1771 gene (http:// genolist.pasteur.fr/) A close ortholog of the Rv1771 protein (72% identity) exists in Mycobacterium marinum (http://www.sanger.ac.uk) In Mycobacterium leprae, a possible pseudogene similar to the M tuberculosis Rv1771 sequence is present Other mycobacteria apparently not contain sequences homologous to the Rv1771 protein The predicted molecular mass of the Rv1771 protein is 48 045 kDa, and the pI is 7.14 Like the animal and plant l-gulono-1,4-lactone oxidases ⁄ dehydrogenases, the M tuberculosis Rv1771 protein possesses in its N-terminus an FAD-binding site (VGSGH49S) with a conserved histidine residue that in the rat l-gulono-1,4-lactone oxidase enzyme (VGGGH54S) participates in the covalent binding of the FAD molecule [22] (Fig 2) Analysis of the denatured Rv1771 protein by SDS ⁄ PAGE according to the method of Nishikimi et al [23] did not reveal the presence of any fluorescent protein band, thus pointing to the absence of a covalently bound flavin moiety in the recombinant product Moreover, as in the case of the plant l-galactono-1,4-lactone dehydrogenase [12], the native recombinant dehydrogenase of M tuberculosis did not show a typical flavin protein absorption spectrum, and addition of exogenous FAD (100 lm) or riboflavin (1 mm) had no effect on the enzyme Fig Sequence analysis of the Rv1771 L-gulono-1,4-lactone dehydrogenase of M tuberculosis The amino acids (16–168) that form the FAD-binding domain (pfam designation PF01565) are highlighted in black The D-arabinono-1,4-lactone oxidase domain (pfam designation PF04030) (amino acids 172–427) is highlighted in gray The position of a potential transmembrane helice (amino acids 205–227) is indicated by bold italics Tryptic peptides identified by MALDI Q-TOF MS are underlined FEBS Journal 273 (2006) 4435–4445 ª 2006 The Authors Journal compilation ª 2006 FEBS 4437 M tuberculosis L-gulono-1,4-lactone dehydrogenase B A Wolucka and D Communi activity (results not shown) These results suggest that the mycobacterial dehydrogenase, like the cauliflower l-galactono-1,4-lactone dehydrogenase [12], is not a flavoenzyme The C-terminus of the Rv1771 protein contains a d-arabinono-1,4-lactone domain (Pfam04030) (Fig 2) that is present in all known aldonolactone oxidoreductases In order to determine the enzymatic activity of the GST-tagged Rv1771 protein of M tuberculosis, the oxidase activity was tested in the presence of the l-gulono-1,4-lactone and l-galactono-1,4-lactone substrates, as described [24], but no activity could be detected However, the enzyme could oxidize l-gulono-1,4-lactone aerobically by using exogenous cytochrome c from horse heart as an electron acceptor (Table 1) l-Galactono-1,4-lactone and other sugar derivatives did not serve as substrates in the dehydrogenase reaction (Table 1) Interestingly, phenazine methosulfate could substitute for cytochrome c and was about three times more efficient as a direct electron acceptor than the latter (Table 1) 2,6-dichloroindophenol alone could not serve as electron acceptor in the dehydrogenase reaction (not shown) Thus, like the plant l-gulono-1,4lactone and l-galactono-1,4-lactone dehydrogenases [9,12], the mycobacterial enzyme acts exclusively as a dehydrogenase and does not use molecular oxygen as an electron acceptor In contrast to the animal and plant l-gulono-1,4-lactone oxidoreductases, the mycobacterial enzyme is specific for l-gulono-1,4-lactone and has no activity towards l-galactono-1,4-lactone (Table 1) The steady-state parameters of the recombinant l-gulono-1,4-lactone dehydrogenase of M tuberculosis were determined The dehydrogenase obeys Michaelis–Menten kinetics with l-gulono-1,4-lactone and cytochrome c as substrates (Fig 3A,B) The apparent Km values for l-gulono-1,4-lactone and cytochrome c Table Substrate specificity of the recombinant GST-tagged L-gulono-1,4-lactone dehydrogenase of M tuberculosis ND, not determined All measurements were made in triplicate The limit of detection was 0.3 mmg protein)1 Mean values ± SD are given Enzyme specific activity with different electron acceptors (mmg protein)1) Substrate (50 mM) Cytochrome c (121 lM) Phenazine methosulfate (2.5 mM) L-Gulono-1,4-lactone 66.7 ± 4.0 0a 0 0 249 ± 17.4 ND ND ND ND ND L-Galactono-1,4-lactone D-Glucurono-3,6-lactone D-Glucuronic D-Arabinose D-Xylose a acid Measured values were equal to or below the detection limit 4438 were determined to be 5.5 mm (Fig 3A) and 4.7 lm (Fig 3B), respectively The Vmax value was determined to be 2.44 lmolỈh)1Ỉmg protein)1 (Fig 3A) The kinetic parameters of the recombinant GST-tagged mycobacterial l-gulono-1,4-lactone dehydrogenase are therefore similar to those reported for the plant l-galactonolactone dehydrogenase (Km values equal 3.3 mm and 3.6 lm for l-galactono-1,4-lactone and cytochrome c, respectively) [12,25] These results suggest that the mycobacterial enzyme could operate efficiently in vivo Optimal conditions for the mycobacterial dehydrogenase activity were determined The optimal pH for the dehydrogenase reaction is between 7.5 and (Fig 4A) At higher pH values, enzyme activity rapidly decreased, probably because of hydrolysis of the lactone substrate As for the mammalian l-gulono-1,4lactone oxidases [26], the temperature optimum for the dehydrogenase reaction was relatively high (39 °C) (Fig 4B) Preincubation at 60 °C for resulted in only partial inactivation of the enzyme (53% of control), thus indicating that the dehydrogenase is relatively heat-stable The enzyme was completely inhibited by mm N-ethylmaleimide, Cu2+ and Zn2+ (results not shown) These effects suggest the involvement of sulfhydryl group(s) in the catalytic activity of the mycobacterial enzyme, as observed for the plant l-galactono-1,4-lactone dehydrogenase [12,25] No dehydrogenase activity could be measured in the presence of mm potassium cyanide Mg2+ and Ca2+ had no effect on the dehydrogenase activity, and mm Mn2+ slightly inhibited the enzyme (21% inhibition) However, the mycobacterial dehydrogenase requires for its activity trace amounts of a divalent metal ion, because the enzyme was inactive in the presence of mm EDTA Presence of L-gulono-1,4-lactone dehydrogenase activity in M bovis BCG strain Copenhagen Crude extracts of exponentially growing M bovis BCG were prepared as described in Experimental procedures The dehydrogenase activity could be measured in the soluble extracts [0.17 mmg protein)1], but not in the insoluble fraction, because of interfering contaminants The determined activity of the mycobacterial enzyme was comparable with that reported for crude preparations of plant l-galactono-1,4-lactone dehydrogenase [12,27], Thus, in agreement with previous results [28,29], the Rv1771 protein is expressed in the M tuberculosis complex; it is probably loosely associated with the cell membrane [29], and is enzymatically active In spite of the presence of dehydrogenase activity, ascorbic acid could not be detected in FEBS Journal 273 (2006) 4435–4445 ª 2006 The Authors Journal compilation ª 2006 FEBS M tuberculosis L-gulono-1,4-lactone dehydrogenase B A Wolucka and D Communi A 45 B 60 1/V0 1/V0 40 50 35 40 30 25 30 y = 0,1371x + 28,762 20 20 15 y = 135,11x + 24,829 10 10 -0,3 -0,2 -0,1 0,1 0,2 0,3 1/[L-gulono-1,4-lactone] (mM-1) -300 -250 -200 -150 -100 -50 50 100 150 1/[cyt c] (µM)-1 A 0.1 Enzyme activity Fig Characterization of the recombinant GST-tagged L-gulono-1,4-lactone dehydrogenase (Rv1771) of M tuberculosis Steady-state parameters of the mycobacterial dehydrogenase determined for: (A) the L-gulono-1,4-lactone substrate in the presence of 121 lM cytochrome c; and (B) the cytochrome c substrate in the presence of 50 mM L-gulono-1,4-lactone Double-reciprocal Lineweaver–Burke plots are shown V0 is lmol of L-gulono-1,4-lactone oxidized per and per mg of the recombinant dehydrogenase (mg protein)1) L-Gulono-1,4-lactone concentrations ranged from to 25 mM, whereas cytochrome c concentrations ranged from 24 to 145 lM (B) All measurements were made in duplicate in three independent experiments; the values obtained in a representative experiment are shown 0.08 Discussion 0.06 0.04 0.02 5.5 6.5 7.5 8.5 B 500 Enzyme activity (% of control) pH 400 300 200 100 20 30 40 50 Temperature (°C) Fig Effects of pH (A) and temperature (B) on the activity of the recombinant GST-tagged L-gulono-1,4-lactone dehydrogenase of M tuberculosis Measurements were made in duplicate; mean values ± SD are shown In (A), the dehydrogenase activity is expressed as DA550 per In the present work, we identified a novel l-gulono1,4-lactone dehydrogenase (Rv1771) of M tuberculosis that catalyzes the reaction depicted in Fig The Rv1771 gene was difficult to express in E coli, and only small quantities of the corresponding GST-tagged protein could be obtained (Fig 1) The enzyme has an absolute specificity for the l-gulono-1,4-lactone substrate (Km 5.5 mm) (Fig 3A) and shows no activity with l-galactono-1,4-lactone (Table 1) Thus, the mycobacterial enzyme differs from the known l-gulono-1,4-lactone oxidases (EC 1.1.3.8), which oxidize both l-gulono-lactone and l-galactono-1,4-lactone [13,17], and also from plant [12], yeast [15] and trypanosomal [19] l-galactono-1,4-lactone oxidoreductases, which are inactive towards l-gulono-1,4-lactone Because l-galactono-1,4-lactone is not a substrate for the mycobacterial dehydrogenase, we presume that d-arabinono-1,4-lactone, a five-carbon homolog of l-galactono-1,4-lactone, is not a substrate either Thus, the mycobacterial dehydrogenase is unusual in its selectivity for l-gulono-1,4-lactone Our preparations of the recombinant dehydrogenase of M tuberculosis H the acid extracts obtained from M bovis BCG Copenhagen or M tuberculosis H37Rv cells (results not shown) Possible explanations are that the levels of extracted ascorbic acid were below the detection limit of the HPLC method, or that M tuberculosis cells did not synthesize vitamin C in the in vitro culture conditions used in this study cyt cox CH2OH OH O H O H HO cyt cred H CH2OH OH O O O H OH L-gulono-1,4-lactone OH L-ascorbic acid Fig Reaction catalyzed by the L-gulono-1,4-lactone dehydrogenase of M tuberculosis FEBS Journal 273 (2006) 4435–4445 ª 2006 The Authors Journal compilation ª 2006 FEBS 4439 M tuberculosis L-gulono-1,4-lactone dehydrogenase B A Wolucka and D Communi had low specific activity, ranging from 40 to 66 mmg protein)1 under the nonoptimal temperature conditions of the enzyme assay (24 °C) However, taking into account that the enzyme activity is about three-fold higher at 39 °C (Fig 4B) and that the GSTtagged Rv1771 protein represented only a portion of the GST affinity-purified fraction (Fig 1, lane 4), the specific activity of the recombinant dehydrogenase could be at least 10-fold higher [400–660 mmg protein)1] The relatively low activity of the recombinant M tuberculosis enzyme could be due to impaired protein folding, proteolytic degradation and ⁄ or the lack of a mycobacterial cofactor in the E coli expression system Another possibility is that the mycobacterial dehydrogenase might require a specific post-translational modification that occurs inefficiently in the E coli host As far as we know, the specific activities of related recombinant enzymes of plant origin have not been reported Moreover, huge differences in the specific activities of purified native aldonolactone oxidoreductases, ranging from 760 mmg protein)1 [17] up to 51 000 mg protein)1 [12], have been observed In particular, specific activity values determined for the native l-galactono-1,4-lactone dehydrogenase of sweet potato [30] were 1000-fold higher than those reported for the same enzyme by others [27], but no explanation for this discrepancy was provided l-Gulonolactone dehydrogenase activity could be measured in the soluble fraction of the M bovis BCG Copenhagen strain, and its specific activity was comparable to that reported for crude preparations of the related l-galactono-1,4-lactone dehydrogenase of plant origin [9,12,27] Altogether, our results suggest that the mycobacterial enzyme could operate efficiently in vivo Other proteomic studies have demonstrated that the Rv1771 protein is relatively abundant in the M bovis BCG strain [28] and also in M tuberculosis H37Rv, especially in the cell envelope fraction [29] Indeed, the Rv1771 protein contains a potential transmembrane helix (amino acids 205–227), as predicted by the tmpred program (http://www.ch.embnet.org/ software/TMPRED_form.html) (Fig 2) Thus, like all the known aldonolactone oxidoreductases, the Rv1771 protein may be membrane-associated, in agreement with the enzyme behavior in the presence of a detergent In contrast to the related aldonolactone oxidases [13,16,19], but similar to the plant l-galactono-1,4-lactone dehydrogenases (EC 1.3.2.3) [12], the mycobacterial enzyme does not use molecular oxygen as an electron acceptor, and has dehydrogenase activity (Table 1; Fig 3B) Interestingly, a dehydrogenase activity of the rat l-gulono-1,4-lactone oxidase was reported in the early literature [26,31], but the activity was not studied 4440 further Nowadays, the l-gulono-1,4-lactone oxidase enzymes are considered exclusively as oxidases, the reaction products of which are, paradoxically, L-AA and hydrogen peroxide [8] Dehydrogenase-to-oxidase conversion is well known for another antioxidant (uric acid)-producing enzyme, xanthine oxidoreductase [32] Perhaps a similar molecular mechanism might be responsible for the dehydrogenase-to-oxidase switch of mammalian l-gulono-1,4-lactone oxidase proteins and play a role in the metabolism of L-AA We showed that in vitro both cytochrome c (Km 4.7 lm) (Fig 3B) and phenazine methosulfate (Table 1) can serve as electron acceptors for the l-gulono-1,4-lactone dehydrogenase of M tuberculosis Remarkably, the phenazine methosulfate acceptor was even more efficient than cytochrome c at saturation (Table 1) Phenazines, ‘secondary metabolites’ of certain soil and pathogenic bacteria, are redox-active, flavin-like low-molecular-weight compounds that can produce ROS and play a role in quorum sensing and biofilm formation in Pseudomonas aeruginosa lung infection [33] It is possible, therefore, that an unknown phenazine-like, low-molecular-weight compound might serve as an endogenous electron acceptor for the Rv1771 dehydrogenase of M tuberculosis Despite the presence of l-gulono-1,4-lactone dehydrogenase activity in the M bovis BCG Copenhagen strain, ascorbic acid could not be detected in the M bovis BCG and M tuberculosis cells grown in vitro, either because its concentrations were below the detection limit or because of the lack of the l-gulono-1,4-lactone substrate in these cells l-Gulono-1,4-lactone can be formed by the C1 reduction of d-glucuronic acid or d-glucurono-3,6-lactone [8] An NADPH-dependent d-glucurono-3,6-lactone reductase activity is present in cellular extracts of M bovis BCG (B A Wolucka, unpublished results) and could supply l-gulono-1,4-lactone for the dehydrogenase reaction In the animal pathway for vitamin C, free d-glucuronic acid is derived from UDP-d-glucuronate either directly by the recently proposed abortive reaction catalyzed by a UDP-glucuronosyl transferase [34] or via some poorly characterized hydrolytic steps [8] UDP-Glucuronate, in turn, is synthesized from UDP-glucose by a UDPglucose dehydrogenase Mycobacterium tuberculosis possesses a gene encoding a putative UDP-glucose dehydrogenase (Rv0322) that is necessary for UDPglucuronic acid formation Moreover, the pathogen synthesizes some unknown d-glucuronate-containing glycoconjugates, as demonstrated by immunochemical methods [35], and therefore must express UDP-glucuronosyltransferase(s) Accordingly, a complete pathway for vitamin C synthesis, similar to the animal route FEBS Journal 273 (2006) 4435–4445 ª 2006 The Authors Journal compilation ª 2006 FEBS M tuberculosis L-gulono-1,4-lactone dehydrogenase B A Wolucka and D Communi [8,34], may exist in M tuberculosis but operate only in specific conditions Examples of differential regulation of gene expression and metabolic reprogramming in M tuberculosis are known [36,37] Some earlier steps in a pathway for ascorbic acid might be inducible, e.g during the intracellular growth of the pathogen in its host This could explain the absence of the l-gulono1,4-lactone dehydrogenase reaction product in the M tuberculosis cells grown in vitro The Rv1771 l-gulono-1,4-lactone dehydrogenase of M tuberculosis is a specific enzyme for the biosynthesis of L-AA As far as we know, this is the first report of a specific biosynthetic enzyme for vitamin C in bacteria To detect related aldonolactone dehydrogenases ⁄ oxidases in other bacterial genomes, we used the rat l-gulono-1,4-lactone oxidase as a query sequence in blast searches of the protein database These searches retrieved, for a limited number of bacterial species, additional putative aldonolactone oxidase orthologs that display significant sequence identity (about 30%) with the rat l-gulono-1,4-lactone oxidase protein, and are closely related to the known and predicted l-gulono-1,4-lactone oxidase-like proteins of animals, plants and fungi (Fig 6) Surprisingly, an important number of bacterial species that contain a vitamin C biosynthetic gene belong to the Actinomycetales [M tuberculosis, M bovis, Thermobifida fusca, Streptomyces coelicolor and Streptomyces avermitilis (NP_823585)] It is worth noting that members of the Actinomycetales (Streptomyces verticillus and Saccharothrix mutabilis) possess orthologs of another vitamin C-related enzyme, namely the plant GDP-mannose-3¢,5¢-epimerase [38] Ancestral soil-based organisms might therefore play a role in horizontal transfer of vitamin C-related genes In the process of microbial adaptation, horizontal gene transfer is essential for the dissemination and assembly of detoxification pathways that can form part of genomic islands and have both pathogenicity and degradation functions [39] Remarkably, several l-gulono-1,4-lactone oxidase-positive bacteria are known pathogens [M tuberculosis, M bovis, Burkholderia cepacia, Bacillus anthracis (NP_654628) and Pseudomonas aeruginosa (NP_254014)] that infect human lungs On the other hand, photosynthetic cynobacteria that were largely believed to be able to synthesize vitamin C not, apparently, contain l-gulono-1,4-lactone oxidase homologs, with the exception of Nostoc punctiforme These surprising findings raise important questions about the role of aldonolactone oxidoreductases in prokaryotic organisms and the evolution of vitamin C biosynthetic pathways in general What could be the physiologic role of the Rv1771 protein in M tuberculosis? Mycobacterium tuberculosis Fig Sequence relationship between L-gulono-1,4-lactone dehydrogenase of M tuberculosis and previously identified or predicted L-gulono-1,4-lactone oxidase-like proteins The unrooted neighborjoining (N-J) tree was generated (http://align.genome.jp) on the basis of the amino acid sequences of proteins that show at least 30% identity with the rat L-gulono-1,4-lactone oxidase The accession numbers of the sequences used were: M tuberculosis L-gulono-1,4-lactone dehydrogenase, NP_216287; Streptomyces coelicolor, NP_629980; Thermobifida fusca, ZP_00059445; Oceanobacillus iheyensis, NP_692632; Bacillus cereus, NP_830486; Burkholderia cepacia, ZP_00218082; Saccharomyces cerevisiae D-arabinono-1,4-lactone oxidase (ALO), P54783; Candida albicans D-arabinono-1,4-lactone oxidase (ALO), O93852; Neurospora crassa, Q7SGY1; Gibberella zeae, XP_388870; Arabidopsis thaliana L-galactono-1,4-lactone dehydrogenase (GLDH), At3g47930; Arabidopsis thaliana putative L-gulono-1,4-lactone dehydrogenase, At2g46740; Sus scrofa L-gulono-1,4-lactone oxidase (GLO), Q8HXWO; Rattus norvegicus L-gulono-1,4-lactone oxidase (GLO), P10867 has coevolved with its human host, and may persist for years in a strange symbiosis known as latent infection According to World Health Organisation estimates (http://www.who.int/mediacentre/factsheets/ fs104/en/), about one-third of the world’s population is infected with M tuberculosis but only 5–10% of the infected persons will develop active disease The Rv1771 gene is apparently not essential, because transposon mutants of the gene could be obtained [40] The gene is well conserved within the M tuberculosis complex, except for the M bovis BCG Pasteur (1173P2) strain, which lost the gene due to the deletion of chromosomal region RD14 [41] Ironically, whereas the pathogen’s ortholog is well conserved, the l-gulono-1,4-lactone oxidase gene of tuberculosisprone species, such as humans and guinea pigs, is nonfunctional because of mutations accumulated during evolution [8] These facts strongly suggest that the l-gulonolactone dehydrogenase of M tuberculosis could play a role in virulence, pathogenesis and ⁄ or survival of the parasite within its host In agreement FEBS Journal 273 (2006) 4435–4445 ª 2006 The Authors Journal compilation ª 2006 FEBS 4441 M tuberculosis L-gulono-1,4-lactone dehydrogenase B A Wolucka and D Communi with this, a deficiency in d-arabinono-1,4-lactone oxidase (ALO1), which catalyzes the last step in the biosynthesis of erythroascorbic acid in yeasts, resulted in attenuated virulence of the Candida albicans mutant [42] If synthesized by the Rv1771 l-gulono1,4-lactone dehydrogenase, L-AA may represent a novel weapon in the antioxidative arsenal of the pathogen at least in some, although still unknown, stages of M tuberculosis infection Interestingly, the promoter of the cell wall catalase-peroxidase ⁄ NADH oxidase [43] gene katG of M tuberculosis, which is important for virulence and for the activation of the antimycobacterial prodrug isoniazid, is induced by ascorbic acid [44] Moreover, M tuberculosis possesses an ascorbic acid-dependent isomerase that converts a-acetohydroxyacids to the corresponding a-ketoacids in the pathway for branched-chain amino acids [45] These observations suggest that L-AA could act in M tuberculosis as a modulator of gene expression and an enzyme cofactor, in addition to its possible antioxidant function In summary, the l-gulono-1,4-lactone dehydrogenase of M tuberculosis is a new and distinct member of the family of l-gulono-1,4-lactone dehydrogenase ⁄ oxidases that have been characterized up to now, and the first example of a specific, vitamin C biosynthetic enzyme of bacterial origin Further studies will be necessary to elucidate the role of the Rv1771 l-gulono-1,4-lactone dehydrogenase in M tuberculosis infection Heterologous expression of the recombinant L-gulono-1,4-lactone dehydrogenase Escherichia coli cells carrying the pDEST15_Rv1771 plasmid were grown at 37 °C to an optical density of 0.8 at 600 nm in 200 mL of culture volume, and then IPTG was added to a final concentration of 0.1 mm for induction, and the fusion protein was produced for h or h, as indicated The cells were washed, resuspended in three volumes of 100 mm phosphate buffer (pH 7.3) containing 0.1% Triton X-100, mm dithiothreitol, mm phenylmethanesulfonyl fluoride and 20% glycerol, and sonicated After centrifugation at 13 000 g for 15 at °C on an Eppendorf 5402 centrifuge (Eppendorf, Hamburg, Germany), the supernatant was loaded onto a GST affinity column GST affinity chromatography of the recombinant L-gulono-1,4-lactone dehydrogenase of M tuberculosis Experimental procedures Chemicals GST affinity and StrataClean resins were obtained from Stratagene (Madison, WI) l-Gulono-1,4-lactone, cytochrome c from horse heart (oxidized form), phenazine methosulfate and 2,6-dichloroindophenol were purchased from Sigma-Aldrich (St Louis, MO) All reagents were of analytical grade Plasmid construction The ORF corresponding to the mycobacterial Rv1771 l-gulonolactone dehydrogenase (1287 bp) was PCR amplified from the genomic DNA of M tuberculosis H37Rv Oligonucleotide primers were designed with attB1 or attB2 sites for insertion into the Gateway donor vector pDONR201 (Invitrogen, Gaithersburg, MD) by homologous recombination A sequence (GATGACGACGACAAG) corresponding to the enterokinase cleavage site (DDDDK) was included within the forward primer immediately 4442 upstream of the start codon (ATG) Primers with the following sequences were synthesized by Proligo (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT A-3¢ The PCR product was cloned into the pDONR201 vector, and the resulting plasmid, pENTR_Rv1771, was used to transfer the gene sequence into pDEST15 (Invitrogen) (GST tag N-terminal fusion) by means of homologous recombination The pDEST15_Rv1771 (GST fusion) plasmid obtained was used for expression of the protein in E coli BL21(DE3) cells A crude extract containing the GST-tagged dehydrogenase was applied to a mL GST affinity column equilibrated with 50 mm phosphate buffer (pH 7.3) containing 0.1% Triton X-100, mm phenylmethanesulfonyl fluoride and 20% glycerol (buffer A) The column was washed with 15 volumes of buffer A, and the recombinant dehydrogenase was eluted with three volumes of 10 mm glutathione (reduced form) in buffer A Fractions containing the recombinant dehydrogenase were pooled For measurements of the l-gulono-1,4-lactone dehydrogenase activity, glutathione and dithiothreitol were removed by gel filtration of the pooled GST affinity fractions on a prepacked NAP-25 column (Amersham Pharmacia Biotech, Uppsala, Sweden) Enterokinase cleavage of the GST-tagged L-gulono-1,4-lactone dehydrogenase In order to remove the GST tag, an aliquot of the affinitypurified recombinant dehydrogenase was incubated for 24 h FEBS Journal 273 (2006) 4435–4445 ª 2006 The Authors Journal compilation ª 2006 FEBS B A Wolucka and D Communi at 22 °C with units of enterokinase (Stratagene) in 500 lL (final volume) of 20 mm Tris ⁄ HCl buffer (pH 8.0) containing 50 mm NaCl and mm CaCl2 One unit of enterokinase is the amount of enzyme required to cleave 100 lg of the CBP-EK-JNK fusion protein (Stratagene) to 90% completion at 21 °C in 16 hours Concentration of protein fractions on Strataclean beads To pooled GST affinity fractions, 10 lL of Strataclean resin suspension was added After overnight incubation at °C, samples were centrifuged at 13 000 g for at room temperature on a Microfuge 18 centrifuge (BeckmanCoulter, Fullerton, CA), and the supernatants discarded The adsorbed proteins were recovered by heating the beads in three volumes of the five-times concentrated sample buffer for at 100 °C After centrifugation at 13 000 g for at room temperature on a Microfuge 18 centrifuge (Beckman-Coulter), the concentrated proteins were analyzed by SDS ⁄ PAGE M tuberculosis L-gulono-1,4-lactone dehydrogenase the decrease in absorbance at 610 nm due to the reduction of 2,6-dichloroindophenol was measured, as described [47] PAGE Proteins were separated by SDS ⁄ PAGE, using 10% minigels and the buffer system described by Laemmli [48] Gels were stained with Coomassie Brilliant Blue R-250 Immunoblotting Samples fractionated by SDS ⁄ PAGE were transferred to a nitrocellulose membrane by electroblotting (Bio-Rad, Hercules, CA) according to the manufacturer’s protocol Membranes were incubated with goat anti-GST IgG (1 : 1000 dilution; Amersham Pharmacia Biotech), and antibody binding was detected using anti-goat IgG conjugated to alkaline phosphatase (1 : 5000 dilution; Sigma-Aldrich) and the 5-bromo-4-chloro-3-indolyl-phosphate ⁄ nitroblue tetrazolium reagent (Promega, Madison, WI) MS Preparation of crude enzyme extracts from M bovis BCG The M bovis BCG strain Copenhagen cultures were grown to mid-exponential phase in Middlebrook 7H9 medium containing ADC enrichment (Becton Dickinson, San Jose, CA) at 37 °C, without agitation Cells were collected by centrifugation at 1500 g for 15 at °C, on a Sorvall RC5B plus centrifuge (Sorvall, Ashville, NC), resuspended in 100 mm phosphate buffer (pH 7.3) containing mm phenylmethanesulfonyl fluoride, and disrupted by sonication Unbroken cells were removed by centrifugation at 500 g for 15 at °C, and the supernatant was further centrifuged at 25 000 g as described above The obtained soluble extract and the insoluble cell envelope fraction, previously resuspended in the extraction buffer, were used for measurements of l-gulono-1,4-lactone dehydrogenase activity Assay of L-gulono-1,4-lactone dehydrogenase The reaction mixture (1 mL) contained 25 mm l-gulono1,4-lactone, 0.121 mm cytochrome c and an aliquot of the affinity-purified dehydrogenase in 50 mm phosphate buffer (pH 7.3) Because dithiothreitol and glutathione interfered with the enzyme assay, they were removed by gel filtration prior to measurements l-Gulono-1,4-lactone dehydrogenase activity was measured spectrophotometrically at 550 nm by following the l-gulono-1,4-lactone-dependent reduction of cytochrome c [46] When indicated, 2.5 mm phenazine methosulfate was used as a direct electron acceptor in the presence of 100 lm 2,6-dichloroindophenol, and MALDI quadrupole TOF (MALDI Q-TOF) MS analysis of in-gel-digested protein bands was performed on a Q-TOF Ultima Global mass spectrometer equipped with a MALDI source (Micromass, Waters Corporation, Milford, MA), as described [49] Protein determination Protein concentration was determined by the method of Bradford [50], using BSA as standard Ascorbic acid determination Mycobacterial cells were extracted with 5% m-phosphoric acid [51] or 5% perchloric acid [52], as described Ascorbic acid was measured by the HPLC method [51] by using an Alliance separation module equipped with an M2996 photodiode array detector and the empower chromatography software (Waters Corporation) Acknowledgements We wish to thank Dr P Jungblut (Max Planck Institute for Infection Biology, Berlin) for a gift of the M bovis BCG strain Copenhagen We thank Virginie Imbault for technical assistance in MS This work was partially supported by the Fonds de la Recherche Scientifique ´ Medicale, Belgium (convention no 3.4.626.05.F to BAW) DC is Research Associate at the Fonds National de la Recherche Scientifique (FNRS) FEBS Journal 273 (2006) 4435–4445 ª 2006 The Authors Journal compilation ª 2006 FEBS 4443 M tuberculosis L-gulono-1,4-lactone dehydrogenase B A Wolucka and D Communi References Schwager J & Schulze J (1998) Modulation of interleukin production by ascorbic acid Vet Immunol Immunopathol 64, 45–57 Margittai E, Banhegyi G, Kiss A, Nagy G, Mandl J, Schaff Z & Csala M (2005) Scurvy leads to endoplasmic reticulum stress and apoptosis in the liver of guinea pigs J Nutr 135, 2530–2534 Dhar-Mascareno M, Carcamo JM & Golde DW (2005) Hypoxia–reoxygenation-induced mitochondrial damage and apoptosis in human endothelial cells are inhibited by vitamin C Free Radic Biol Med 38, 1311– 1322 Fischer H, Schwarzer C & Illek B (2004) Vitamin C controls the cystic fibrosis transmembrane conductance regulator chloride channel Proc Natl Acad Sci USA 101, 3691–3696 Brown LAS & Jones DP (1997) Antioxidant action of vitamin C in the lung In Vitamin C in Health and Disease (Packer L & Fuchs J, eds), pp 265–278 Marcel Dekker, New York May JM, Huang J & Qu ZC (2005) Macrophage uptake and recycling of ascorbic acid: response to activation by lipopolysaccharide Free Radic Biol Med 39, 1449–1459 Valpuesta V & Botella MA (2004) Biosynthesis of l-ascorbic acid in plants: new pathways for an old antioxidant Trends Plant Sci 9, 573–577 Nishikimi M & Yagi K (1996) Biochemistry and molecular biology of ascorbic acid biosynthesis Subcell Biochem 25, 17–39 Wolucka BA & Van Montagu M (2003) GDP-mannose 3¢,5¢-epimerase forms GDP-l-gulose, a putative intermediate for the de novo biosynthesis of vitamin C in plants J Biol Chem 278, 47483–47490 10 Shigeoka S, Nakano Y & Kitaoka S (1979) Some properties and subcellular localization of l-gulono-c-lactone dehydrogenase in Euglena gracilis z Agric Biol Chem 43, 2187–2188 11 Mapson LW & Breslow E (1958) Biological synthesis of ascorbic acid: l-galactono-c-lactone dehydrogenase Biochem J 68, 395–406 12 Ostergaard J, Persiau G, Davey MW, Bauw G & Van Montagu M (1997) Isolation of a cDNA coding for l-galactono-c-lactone dehydrogenase, an enzyme involved in the biosynthesis of ascorbic acid in plants Purification, characterization, cDNA cloning, and expression in yeast J Biol Chem 272, 30009–30016 13 Kiuchi K, Nishikimi M & Yagi K (1982) Purification and characterization of l-gulonolactone oxidase from chicken kidney microsomes Biochemistry 21, 5076– 5082 14 Loewus FA (1999) Biosynthesis and metabolism of ascorbic acid in plants and of analogs of ascorbic acid in fungi Phytochemistry 52, 193–210 4444 15 Bleeg HS & Christensen F (1982) Biosynthesis of ascorbate in yeast Purification of l-galactono-1,4-lactone oxidase with properties different from mammalian l-gulonolactone oxidase Eur J Biochem 127, 391– 396 16 Huh WK, Kim ST, Yang KS, Seok YJ, Hah YC & Kang SO (1994) Characterisation of d-arabinono-1,4lactone oxidase from Candida albicans ATCC 10231 Eur J Biochem 225, 1073–1079 17 Nishikimi M, Noguchi E & Yagi K (1978) Occurrence in yeast of l-galactonolactone oxidase which is similar to a key enzyme for ascorbic acid biosynthesis in animals, l-gulonolactone oxidase Arch Biochem Biophys 191, 479–486 18 Huh WK, Lee BH, Kim ST, Kim YR, Rhie GE, Baek YW, Hwang CS, Lee JS & Kang SO (1998) D-Erythroascorbic acid is an important antioxidant molecule in Saccharomyces cerevisiae Mol Microbiol 30, 895– 903 19 Wilkinson SR, Prathalingam SR, Taylor MC, Horn D & Kelly JM (2005) Vitamin C biosynthesis in trypanosomes: a role for the glycosome Proc Natl Acad Sci USA 102, 11645–11650 20 Koshizaka T, Nishikimi M, Ozawa T & Yagi K (1988) Isolation and sequence analysis of a complementary DNA encoding rat liver l-gulono-c-lactone oxidase, a key enzyme for l-ascorbic acid biosynthesis J Biol Chem 263, 1619–1621 21 Sugisawa T, Ojima S, Matzinger PK & Hoshino T (1995) Microbial production of l-ascorbic acid from d-sorbitol, l-sorbose, l-gulose, and l-sorbosone by Ketogulonicigenium vulgare DSM 4025 Biosci Biotechnol Biochem 59, 190–196 22 Nakagawa H, Asano A & Sato R (1975) Ascorbatesynthesizing system in rat liver microsomes II A peptidebound flavin as the prosthetic group of l-gulono-c-lactone oxidase J Biochem (Tokyo) 77, 221–232 23 Nishikimi M, Kiuchi K & Yagi K (1977) Detection of l-gulono-c-lactone oxidase on SDS-polyacrylamide gels by the fluorescence of its covalently bound flavin FEBS Lett 81, 323–325 24 Kito M, Ohishi N & Yagi K (1991) Micro-determination of l-gulono-c-lactone oxidase activity Biochem Int 24, 131–135 25 Yabuta Y, Yoshimura K, Takeda T & Shigeoka S (2000) Molecular characterization of tobacco mitochondrial l-galactono-c-lactone dehydrogenase and its expression in Escherichia coli Plant Cell Physiol 41, 666–675 26 Eliceiri GL, Lai EK & McCay PB (1969) Gulonolactone oxidase Solubilization, properties, and partial purification J Biol Chem 244, 2641–2645 27 Imai T, Karita S, Shiratori G, Hattori M, Nunome T, Oba K & Hirai M (1998) l-Galactono-c-lactone dehydrogenase from sweet potato: purification and FEBS Journal 273 (2006) 4435–4445 ª 2006 The Authors Journal compilation ª 2006 FEBS B A Wolucka and D Communi 28 29 30 31 32 33 34 35 36 37 38 39 cDNA sequence analysis Plant Cell Physiol 39, 1350– 1358 Schmidt F, Donahoe S, Hagens K, Mattow J, Schaible UE, Kaufmann SH, Aebersold R & Jungblut PR (2004) Complementary analysis of the Mycobacterium tuberculosis proteome by two-dimensional electrophoresis and isotope-coded affinity tag technology Mol Cell Proteomics 3, 24–42 Mawuenyega KG, Forst CV, Dobos KM, Belisle JT, Chen J, Bradbury EM, Bradbury AR & Chen X (2005) Mycobacterium tuberculosis functional network analysis by global subcellular protein profiling Mol Biol Cell 16, 396–404 Oba K, Ishikawa S, Nishikawa M, Mizuno H & Yamamoto T (1995) Purification and properties of l-galactono-c-lactone dehydrogenase, a key enzyme for ascorbic acid biosynthesis, from sweet potato roots J Biochem (Tokyo) 117, 120–124 Kar NC, Ghosh NC & Guha BC (1963) Microsomal l-gulonolactone dehydrogenase Nature 197, 494–495 Kuwabara Y, Nishino T, Okamoto K, Matsumura T, Eger BT & Pai EF (2003) Unique amino acids cluster for switching from the dehydrogenase to oxidase form of xanthine oxidoreductase Proc Natl Acad Sci USA 100, 8170–8175 Price-Whelan A, Dietrich LE & Newman DK (2006) Rethinking ‘secondary’ metabolism: physiological roles for phenazine antibiotics Nat Chem Biol 2, 71–78 Linster CL & Van Schaftingen E (2006) Glucuronate, the precursor of vitamin C, is directly formed from UDP-glucuronate in liver FEBS J 273, 1516–1527 Wolucka BA, McNeil MR, Kalbe L, Cocito C & Brennan PJ (1993) Isolation and characterization of a novel glucuronosyl diacylglycerol from Mycobacterium smegmatis Biochim Biophys Acta 1170, 131–136 Fenhalls G, Stevens L, Moses L, Bezuidenhout J, Betts JC, Helden PP, Lukey PT & Duncan K (2002) In situ detection of Mycobacterium tuberculosis transcripts in human lung granulomas reveals differential gene expression in necrotic lesions Infect Immun 70, 6330–6338 McKinney JD, Honer zu Bentrup K, Munoz-Elias EJ, Miczak A, Chen B, Chan WT, Swenson D, Sacchettini JC, Jacobs WR Jr & Russell DG (2000) Persistence of Mycobacterium tuberculosis in macrophages and mice requires the glyoxylate shunt enzyme isocitrate lyase Nature 406, 735–738 Wolucka BA, Persiau G, Van Doorsselaere J, Davey MW, Demol H, Vandekerckhove J, Van Montagu M, Zabeau M & Boerjan W (2001) Partial purification and identification of GDP-mannose 3¢,5¢-epimerase of Arabidopsis thaliana, a key enzyme of the plant vitamin C pathway Proc Natl Acad Sci USA 98, 14843–14848 Van der Meer JR & Sentchilo V (2003) Genomic islands and the evolution of catabolic pathways in bacteria Curr Opin Biotechnol 14, 248–254 M tuberculosis L-gulono-1,4-lactone dehydrogenase 40 Lamichhane G, Zignol M, Blades NJ, Geiman DE, Dougherty A, Grosset J, Broman KW & Bishai WR (2003) A postgenomic method for predicting essential genes at subsaturation levels of mutagenesis: application to Mycobacterium tuberculosis Proc Natl Acad Sci USA 100, 7213–7218 41 Behr MA, Wilson MA, Gill WP, Salamon H, Schoolnik GK, Rane S & Small PM (1999) Comparative genomics of BCG vaccines by whole-genome DNA microarray Science 284, 1520–1523 42 Huh WK, Kim ST, Kim H, Jeong G & Kang SO (2001) Deficiency of D-erythroascorbic acid attenuates hyphal growth and virulence of Candida albicans Infect Immun 69, 3939–3946 43 Singh R, Wiseman B, Deemagarn T, Donald LJ, Duckworth HW, Carpena X, Fita I & Loewen PC (2004) Catalase-peroxidases (KatG) exhibit NADH oxidase activity J Biol Chem 279, 43098–43106 44 Mulder MA, Zappe H & Steyn LM (1999) The Mycobacterium tuberculosis katG promoter region contains a novel upstream activator Microbiology 145, 2507–2518 45 Allaudeen HS & Ramakrishnan T (1970) Biosynthesis of isoleucine and valine in Mycobacterium tuberculosis H37Rv II Purification and properties of acetohydroxy acid isomerase Arch Biochem Biophys 140, 245–256 ˆ 46 Oba K, Fukui M, Imai Y, Iriyama S & Nogami K (1994) l-Galactono-c-lactone dehydrogenase: partial characterization, induction of activity and role in the synthesis of ascorbic acid in wounded potato tuber tissue Plant Cell Physiol 35, 473–478 47 Nakagawa H & Asano A (1970) Ascorbate synthesizing system in rat liver microsomes I Gulonolactone-reducible pigment as a prosthetic group of gulonolactone oxidase J Biochem (Tokyo) 68, 737–746 48 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4 Nature 227, 680–685 49 Wittamer V, Franssen JD, Vulcano M, Mirjolet JF, Le Poul E, Migeotte I, Brezillon S, Tyldesley R, Blanpain C, Detheux M et al (2003) Specific recruitment of antigen-presenting cells by chemerin, a novel processed ligand from human inflammatory fluids J Exp Med 198, 977–985 50 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72, 248–254 51 Wolucka BA, Davey MW & Boerjan W (2001) A highperformance liquid chromatography radio method for determination of l-ascorbic acid and guanosine 5¢-diphosphate-l-galactose, key metabolites of the plant vitamin C pathway Anal Biochem 294, 161–168 52 Conklin PL, Pallanca JE, Last RL & Smirnoff N (1997) L-ascorbic acid metabolism in the ascorbate-deficient arabidopsis mutant vtc1 Plant Physiol 115, 1277–1285 FEBS Journal 273 (2006) 4435–4445 ª 2006 The Authors Journal compilation ª 2006 FEBS 4445 ... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT... as a direct electron acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of. .. Arabidopsis thaliana L-galactono-1,4-lactone dehydrogenase (GLDH), At3g47930; Arabidopsis thaliana putative L-gulono-1,4-lactone dehydrogenase, At2g46740; Sus scrofa L-gulono-1,4-lactone oxidase