change access permissions of files
Negotiating agrarian change livelihood agriculations of the commercial craft peasantry in northern vietnam
... of agricultural commercialization Despite this, they still concede the existence of the process of land becoming concentrated in the hands of a small number of landowners, under the process of ... modes of livelihood articulation, in the context of labor scarcity (3) Within the process of the re-organization of rural labor, the inward movement of migrants and the gender re-division of labor, ... Le xi TABLE OF CONTENTS PAGE Acknowledgement iii English Abstract v Thai Abstract viii List of Tables xvii List of Figures xviii Abbreviations xix Unit of Measurement xx Glossary of Terms xxi...
- 347
- 483
- 0
BONDS AND CLIMATE CHANGE THE STATE OF THE MARKET IN 2012 pdf
... efficiency of buildings and industry • Majority of the cUSD1.5bn climatethemed bonds issued by LED manufacturers • USD691m of US municipal bonds issued through a range of initiatives to retrofit residential ... HSBC Climate Change Centre of Excellence and prepared by the Climate Bonds Initiative, presents a first estimate of the outstanding global bond market size linked to key climate change themes, ... cUSD6trn could be required in terms of bank loans as well as bonds The success of climate policies has meant that key clean technologies are now reaching a stage of maturity appropriate for greater...
- 8
- 478
- 0
Forecasting UK GDP growth, inflation and interest rates under structural change: a comparison of models with time-varying parameters potx
... mean of the non-zeros ˜ ˆ ˆ elements of A, M denotes the posterior mean of the variance-covariance of τt , G Working Paper No 450 May 2012 39 ˆ ˜ denotes the posterior mean of the variance of νt ... the diagonal elements of the Cholesky decomposition of vols The prior for the off-diagonal elements At is ˆ A0 ∼ N aols ,V aols ˆ ˆ where aols are the off-diagonal elements of vols , with each ... log of diag(AOLS QOLS AOLS ) × T0 × k where AOLS is the inverse of the Choleski decomposition of QOLS The variance of the prior distribution is set to ¯ The prior distribution for the blocks of...
- 56
- 469
- 1
Báo cáo khoa học: Change in structure of the N-terminal region of transthyretin produces change in affinity of transthyretin to T4 and T3 pdf
... relationship between these two types of changes The work reported here is a planned quantitative analysis in vitro of the relationship between the two types of changes In a previous report [14], ... region of crocTTR was deleted The affinity of T3 and T4 to both TTRs was studied and the results are a powerful demonstration of the relationship between the evolution of the primary structure of ... structures (Cys10 in human TTR) and considered part of the core structure of TTR In general, the character of the N-terminal region of TTRs changed from longer (14 amino acids) and more hydrophobic...
- 11
- 457
- 0
scientific american - 2004 07 - will gene doping change the nature of sport
... SWEENEY is professor and chairman of physiology at the University of Pennsylvania School of Medicine He is a member of the Board of Scientific Councilors for the National Institute of Arthritis ... groups of mice After 10 weeks of exposure, the mice were bred The offspring of mice that breathed unfiltered, polluted air inherited mutations twice as often from their fathers as the offspring ... some of the brightest objects in the universe Genzel’s team has measured the orbital speed of gas clouds within 11 of these systems, giving the first unambiguous measurement of the mass of galaxies...
- 92
- 543
- 0
Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx
... seeded at ml per well of a well plate approximately 24 hrs before transfection DNA (3 ug total) was diluted into 100 ul of Opti-MEM I A mix composed of ul of PromoFectin in 100 ul of Opti-MEM I was ... analysis of the prerRNA sequences upstream of the 18S rRNA of these species revealed no significant similarities among the sequences (data not shown) Functional assays using cloned regions of DNA ... GGGCAGGTGGCGGTGGGTCTTTTACCCCCGTGCGCTCCATGCCGTGGGCACCCGGCCGTTGGCCGTGACAACCCCTGTCTCGCAAGGCTCCGTGCCGCGTGTCAGGCGTCCCCCGCTGTGTCTGGGGT PrimEx Figure of canis familiaris sequence and sequences of the MDCK EcoRI-BamHI fragment in pK9Pol I EB Alignment Alignment of canis familiaris sequence and sequences of the MDCK EcoRI-BamHI...
- 12
- 567
- 0
Health and Quality of Life Outcomes BioMed Central Review Open Access Benefits of psychosocial pdf
... bulk of the research is in the area of supportive and cognitive-behavioral interventions Psychological and QL benefits of psychosocial care There has been a growing proliferation of studies of ... Canadian Association of Psychosocial Oncology has published a book of Standards which details principles of practice, professional issues, and organization and structure of psychosocial oncology ... mentioned briefly above Medical cost offset of psychosocial care General Mental Distress There has been a long history of documentation of the fiscal benefits of psychological interventions for...
- 9
- 298
- 0
Health and Quality of Life Outcomes BioMed Central Research Open Access Impact of stress docx
... School of the Age of Enlightenment: A replication study Education 1989, 109:302-304 Hall PD The effect of meditation on the academic performance of African American college students Journal of Black ... the readiness of school boards to address these needs, the testing and implementation of promising intervention programs is of great urgency One approach to the growing problem of school-related ... http://www.hqlo.com/content/1/1/10 examination of the effects of TM on improving school-related behaviors in youth is warranted This study was part of a larger study examining the impact of stress reduction via TM...
- 7
- 391
- 0
Health and Quality of Life Outcomes BioMed Central Commentary Open Access Evaluation of support pptx
... of their social support networks [4] Models of care have evolved which place greater emphasis on meeting the needs of a particular situation, rather than on the roles of particular health professionals ... manifestations of a disease, but also to a variety of external influences [2] Like other aspects of cancer outcomes research, research on HQOL needs to involve the perspectives of the recipients of care, ... only because of the importance of focusing on HQOL outcomes not only at the level of populations, but also at the level of individuals [2,5] Although reliable and valid indicators of HQOL are...
- 6
- 317
- 0
Health and Quality of Life Outcomes BioMed Central Research Open Access Quality of life in lung potx
... patients' perceptions of quality of life List of abbreviations NHP: the Nottingham Health Profile; EORTC QLQ-C30: the European Organization for Research and Treatment of Cancer Quality of Life Questionnaire; ... patients of lower socioeconomic status with patients of higher social class [14] In general the difference in quality of life measures was more profound at baseline than at months in patients of lower ... (pain in other sites of the body) deprived patients showed a greater degree of symptoms (12 out of 13 measures) Of these, significant differences were observed on measures of breathlessness (P...
- 6
- 420
- 0
Health and Quality of Life Outcomes BioMed Central Research Open Access Quality of Life in rural pptx
... means of administration of SF-36, marital status, LCI-M, financial status, occurrence of a grave event during the past year, Global quality of life assessment and type of health problem Because of ... to measure Health-Related Quality of Life in Lebanon The use of such an instrument of QoL would be possible and may change the perspective of health care professionals and health decision makers ... The average time of completion of the SF-36 was 8.4 minutes (SD = 2.9), with a minimum of minutes (0.6% respondents) and a maximum of 20 minutes (0.6% respondents) Only 0.51% of the items were...
- 14
- 361
- 0
Health and Quality of Life Outcomes BioMed Central Research Open Access Quality of life in potx
... form of a quantification of the content of themes between raters and resulted in the above mean inter-rater agreement value An example of a calculation would be: Identification of main theme of ... agreement of a method of contact by the researcher that was acceptable to the team Each keyworker was given a précised copy of the research proposal so that they were aware of the main ethos of the ... still these feeling of ehmmm ehmm sort of combining with other people to one thing." I.3 "There's sort of voices and all sorts of mayhem going on inside and there's not enough of your brain left...
- 11
- 279
- 0
Health and Quality of Life Outcomes BioMed Central Review Open Access Quality of life and potx
... diagnosis Because of this, any interpretation of the impact of diagnosis on QOL must be tentative Related to this is the fact that type of treatment may be reflective of stage of disease (i.e patients ... environment, limited knowledge of health issues and poor general http://www.hqlo.com/content/1/1/33 health Lack of help at home was also predictive of poor QOL Predictors of quality of life in women with ... assessment of QOL was conducted at one day prior to initiation of treatment The final assessment was performed at one year post-treatment The mean age of patients was 55 years Of the Page of (page...
- 6
- 250
- 0
Health and Quality of Life Outcomes BioMed Central Review Open Access Assessment of oral health pot
... issue of ability of health status measures to quantify change is now topical Locker [32] describes four ways of measuring change, namely: 1) comparison of "before" and "after" measurements; 2) change ... quality of life has grown, so has the use of health status measures Patient based assessment of the impact of a wide variety of chronic conditions have been reported The sophistication of measures ... whether weights are of any benefit at all Responsiveness of a measure to change is a complex and controversial issue As assessment of change is a fundamental requirement of all longitudinal study...
- 8
- 256
- 0
Health and Quality of Life Outcomes BioMed Central Review Open Access Quality of life in patients pdf
... the ability of the instrument to be sensitive to different levels of quality of life in a variety of patient groups Discriminative validity is the instrument's ability to detect changes in the ... by Professor Thompson Professor Cheuk-Man Yu was involved in literature review and final endorsement of the manuscript Some of the studies described in the manuscript was organized by Professor ... quality of life [5] While healthcare professionals may be more interested in changes in objective physical measures, patients (and family members/carers) equally interested in a therapy that changes...
- 5
- 503
- 0
Health and Quality of Life Outcomes BioMed Central Review Open Access Impact of Nausea and potx
... postchemotherapy quality of life was assessed days after chemotherapy administration instead of or days The importance of the time of administration and of the time frame of quality of life assessment ... factor of CIE Finally, observational studies showed the importance of the time of administration and of the time frame of quality of life assessment The possibility to identify the impact of CIE ... vomiting Increased severity of vomiting (> episodes) was associated with worsening only of global quality of life and anorexia compared with 1–2 episodes of vomiting Page of 11 (page number not for...
- 11
- 346
- 0
Health and Quality of Life Outcomes BioMed Central Research Open Access Validation of the pptx
... frequently used for assessment of multidisciplinary care in arthritis The effect size of AIMS2 Arthritis Pain was of the same magnitude as the RAOS subscale Pain The effect size of AIMS2 Walking and Bending ... treatments of inflammatory joint diseases the patients stay more alert and live a more active life compared to 10–20 years ago [2–4] This change in physical status calls for assessment of items ... the outcome of patients with chronic inflammatory joint diseases and problems from the lower extremities The aim of the study was to test the reliability, validity and responsiveness of the Rheumatoid...
- 11
- 162
- 0
Health and Quality of Life Outcomes BioMed Central Review Open Access Quality of life in patients pptx
... self-esteem of these children Children with vitiligo usually avoid sport or restrict such activities Children often lose vital days from school Parents of children with vitiligo may have to take time off ... a result of depression and frustration Patients often feel that their family members are not supportive or lack understanding The chronic nature of disease, long term treatment, lack of uniform ... The increase in the level of neuropeptides may be the initiating event in pathogenesis of vitiligo In a study of 150 vitiligo patients, we assessed the nature and extent of the social and psychological...
- 3
- 226
- 0
Health and Quality of Life Outcomes BioMed Central Research Open Access Quality of life in pptx
... Quality of life and cost of multiple sclerosis Clin Neurol Neurosurg 2002, 104(3):272-275 Canadian Burden of Illness Study Group: Burden of Illness of Multiple Sclerosis: Part II: Quality of life ... main use of HRQoL instruments has been in the context of clinical trials, the observation that measures of patients' perception of their health not overlap with clinician assessments of disability ... translated questionnaires and the ease of understanding of the patient In this project, the linguistic validation of the 18 disease-specific questions of the MSQOL-54 was performed solely into...
- 7
- 176
- 0
Health and Quality of Life Outcomes BioMed Central Research Open Access Validation of a general potx
... number of NFO respondents in each of the illness groups, the length of time on the current medication, the route of its administration, their rating of the severity of illness, and their rating of ... extent of patients' understanding of the risk of treatments Quality in Health Care 2001, 10(Suppl 1):i14-i18 Feighner JP: Impact of anxiety therapy on patients' quality of life American Journal of ... irrelevant aspects of care Scales composed of large numbers of detailed and treatment-specific content typically contain a large number of items that are irrelevant to the experiences of a specific...
- 13
- 260
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose