Change in structure of the N-terminal region of transthyretin produces change in affinity of transthyretin to T4 and T3 Porntip Prapunpoj 1 , Ladda Leelawatwatana 1 , Gerhard Schreiber 2 and Samantha J. Richardson 2,3 1 Department of Biochemistry, Faculty of Science, Prince of Songkla University, Hat-Yai, Songkhla, Thailand 2 Department of Biochemistry and Molecular Biology, Bio21 Molecular Science and Biotechnology Institute, The University of Melbourne, Parkville, Victoria, Australia 3 UMR CNRS 5166, Evolution des Re ´ gulations Endocriniennes, Muse ´ um National d’Histoire Naturelle, Paris, France Transthyretin (TTR) is one of the three thyroid hor- mone distributor proteins found in the plasma of lar- ger mammals and was first described in human serum and cerebrospinal fluid (CSF) in 1942 [1,2]. In humans, the main sites of TTR synthesis are the liver and chor- oid plexus. TTR synthesis has been described in all classes of vertebrates [3]. TTR is composed of four identical subunits [4] and, in humans, has a molecular mass of 55 kDa. In most vertebrates, the TTR subunit consists of 127 amino acid residues [5,6]. The tetramer has a central channel with two thyroid hormone bind- ing sites [4]. However, only one binding site of TTR is occupied by thyroid hormone under physiological conditions [7,8], due to negative co-operativity [9]. Although all amino acid residues reported to partici- pate in the binding of thyroid hormones in human TTR are 100% conserved in other vertebrate TTRs, the binding affinity to thyroid hormones varies among animal species: TTR from fish, amphibians, reptiles and birds binds 3¢,5,3-[l]-triiodothyronine (T3) with Keywords N-terminal sequence; protein evolution; recombinant transthyretin; thyroid hormone- binding plasma proteins; thyroid hormone Correspondence P. Prapunpoj, Department of Biochemistry, Faculty of Science, Prince of Songkla University, Hat-Yai, Songkhla 90112, Thailand Fax: +66 74 446656 Tel: +66 74 288275 E-mail: porntip.p@psu.ac.th (Received 4 May 2006, revised 14 June 2006, accepted 3 July 2006) doi:10.1111/j.1742-4658.2006.05404.x The relationship between the structure of the N-terminal sequence of trans- thyretin (TTR) and the binding of thyroid hormone was studied. A recom- binant human TTR and two derivatives of Crocodylus porosus TTRs, one with the N-terminal sequence replaced by that of human TTR (human ⁄ crocTTR), the other with the N-terminal segment removed (trun- cated crocTTR), were synthesized in Pichia pastoris. Subunit mass, native molecular weight, tetramer formation, cross-reactivity to TTR antibodies and binding to retinol-binding protein of these recombinant TTRs were similar to TTRs found in nature. Analysis of the binding affinity to thyroid hormones of recombinant human TTR showed a dissociation constant (K d ) for triiodothyronine (T3) of 53.26 ± 3.97 nm and for thyroxine (T4) of 19.73 ± 0.13 nm. These values are similar to those found for TTR purified from human serum, and gave a K d T3 ⁄ T4 ratio of 2.70. The affinity for T4 of human⁄ crocTTR (K d ¼ 22.75 ± 1.89 nm) was higher than those of both human TTR and C. porosus TTR, but the affinity for T3 (K d ¼ 5.40 ± 0.25 nm) was similar to C. porosus TTR, giving a K d T3 ⁄ T4 ratio of 0.24. A similar affinity for both T3 (K d ¼ 57.78 ± 5.65 nm) and T4 (K d ¼ 59.72 ± 3.38 nm), with a K d T3 ⁄ T4 ratio of 0.97, was observed for truncated crocTTR. The obtained results strongly confirm the hypothesis that the unstructured N-terminal region of TTR critically influences the specificity and affinity of thyroid hormone binding to TTR. Abbreviations CSF, cerebrospinal fluid; RBP, retinol-binding protein; T3, 3¢,5,3-[ L]-triiodothyronine; T4, 5¢,3¢,5,3-[L]-tetraiodothyronine; TTR, transthyretin. FEBS Journal 273 (2006) 4013–4023 ª 2006 The Authors Journal compilation ª 2006 FEBS 4013 higher affinity, whereas TTR from mammals binds 5¢,3¢,5,3-[l]-tetraiodothyronine (T4) with higher affinity [10–14]. The affinity to T4 increased while the affinity to T3 decreased during the evolution of mammalian TTRs from its ancestors. TTRs from 20 vertebrate species, including mam- malian, avian, reptilian, amphibian and fish, were iso- lated and their cDNAs were cloned and sequenced [6,15]. Maximum parsimony analysis of the derived amino acid sequences produced phylogenetic trees of a structure and branching similar to those found in phylogenetic trees based on morphology of animals [14,16]. Comparison of derived amino acid sequences revealed that the amino acid residues involved in the binding of TTR to thyroid hormones remained unchanged during evolution of TTR in vertebrates [see 4,17]. However, the most marked changes in TTR during vertebrate evolution are concentrated in the N-terminal region of the TTR subunit. The N-ter- minal segment is longer and more hydrophobic in avian, reptilian, amphibian and fish than in mamma- lian TTRs. X-ray crystallographic studies revealed that the four N-terminal regions of TTR are unstruc- tured, protrude from the protein tetramer and are located near the entrances to the central channel con- taining the thyroid hormone binding sites [18,19]. Our previous work [6,15] has shown a systematic change during evolution in the N-terminal region of TTR from longer and more hydrophobic to shorter and more hydrophilic in character. The affinity of TTR to T3 and T4 seems also to have changed unidirectionally during evolution [12]. The question arises as to whether there is a causal relationship between these two types of changes. The work reported here is a planned quantita- tive analysis in vitro of the relationship between the two types of changes. In a previous report [14], we demonstrated that the binding affinity of T3 and T4 to crocTTR changed when its N-terminal segment was replaced by that of Xenopus laevis TTR. Here we report the synthesis of two recombinant TTRs in Pichia pastoris which were designed to test specifically the relationship between N-terminal structure of TTR and binding of thyroid hormones. In one of these TTRs, the crocTTR N-ter- minal region was replaced by the N-terminal region of human TTR (whereas crocTTR preferentially binds T3, human TTR preferentially binds T4). In the other, the N-terminal region of crocTTR was deleted. The affinity of T3 and T4 to both TTRs was studied and the results are a powerful demonstration of the rela- tionship between the evolution of the primary structure of the N-terminal regions of TTR and the biological function of TTR. Results Synthesis of recombinant human TTR In the crocodile, TTR is only synthesized in the liver during development in the egg and in hatchlings and only in the choroid plexus of the adult. Thus, it is difficult to obtain the native crocTTR in sufficient amounts for thyroid hormone binding assays. To ensure that recombinant produced in P. pastoris has similar affinity to thyroid hormones as native TTR, recombinant human TTR was synthesized in Pichia was analyzed for affinity to T3 and T4, and affinities were compared to those of human TTR purified from serum. Recombinant human TTR was produced from the cDNA construct in pPIC3.5 but not in pPIC9 (Fig. 1), and had a subunit mass of 15 kDa by SDS ⁄ PAGE, that corresponds to that of TTR purified from human serum. The N-terminal sequences of recombinant human TTR was as expected, i.e. G P T G. Synthesis of recombinant chimeric TTRs Chimeric TTRs were amplified by PCR using specific primer pairs to generate new N-terminal sequences with compatible restriction ends for ligation into the pPIC9 vector (Fig. 2). The transformation efficiency (10 3 )10 4 transformants per 1 lg DNA) was greater than that for recombinant human TTR. The two recombinant crocodile TTRs had masses of 15 kDa 94 67 45 30 21.1 14.4 M r (kDa) 12345678 TTR Fig. 1. Expression of recombinant human TTR. Pichia transformant clones containing human TTR cDNA inserted in pPIC 3.5 or pPIC 9 were grown and induced with methanol for 4 days. Supernatant of the yeast culture was collected and aliquots of 90 lL were ana- lyzed by SDS ⁄ PAGE (15% resolving gel) and protein bands were detected by silver staining. Positions of protein markers and TTR are indicated. Numbers under lanes indicate individual clones with DNA inserted in pPIC3.5 (lanes 1–4) and pPIC9 (lanes 5–8). Function of transthyretin N-terminus P. Prapunpoj et al. 4014 FEBS Journal 273 (2006) 4013–4023 ª 2006 The Authors Journal compilation ª 2006 FEBS by SDS ⁄ PAGE. The N-terminal sequence of recombin- ant truncated crocTTR was as expected, i.e. S K C P. Two additional amino acid residues E and A were found at the N-terminal sequence of human ⁄ crocTTR, i.e. E A G P. Physicochemical properties of the recombinant TTRs P. pastoris expression systems have the potential to perform many of the post-translational modifications typical for higher eukaryotes. Some of these slightly differ from those in mammals. For example, carbohy- drate moieties added to secreted proteins in P. pastoris are predominantly or entirely composed of mannose residues. Moreover, some foreign proteins synthesized in P. pastoris are hyperglycosylated [20]. These mecha- nisms of post-translation differ between P. pastoris and higher eukaryotes, and can lead to alterations of properties and ⁄ or function of the recombinant pro- teins. To ascertain whether unwanted post-transla- tional modifications occurred to the recombinant TTRs in P. pastoris, properties of the proteins were analyzed. Binding to RBP Recombinant human TTR and chimeric TTRs bound to RBP similarly to previously reported for other TTRs [13,14] (Fig. 3). This facilitated in the purifica- tion of TTRs from the P. pastoris culture medium. Approximately 2 mg of purified recombinant human TTR and up to 4 mg of purified chimeric TTRs were obtained from 1 L of P. pastoris culture supernatant by a single purification step of affinity chromatography using an RBP-Sepharose column. A B Fig. 2. Expression vectors for chimeric TTR genes. The expression plasmids for (A) human ⁄ crocTTR and (B) truncated crocTTR were constructed in pPIC9. Proteins were synthesized and secreted using the a-factor protein presegment of Pichia. 5AOX1, pro- motor of P. pastoris alcohol oxidase 1 gene; (3)TT, native transcription termination and polyadenylation signal of alcohol oxidase 1 gene; 3AOX1, sequence from the alcohol oxidase 1 gene, 3¢ to the TT sequences; HIS4; histidinol dehydrogenase gene; Amp, ampicillin resistance gene, ColE1, Escheri- chia coli origin of replication; SalI, SalI restriction site for linearization of the vector. Numbering of amino acid residues, based on that for human TTR [31], was provided underneath the amino acid sequence. (black shading, fragment of human TTR cDNA and grey shading, fragment of crocTTR cDNA. 0.0 0.2 0.4 0.6 0.8 1.0 1.2 0 5 10 15 20 25 Elution volume (ml) mn 082 ta ecnabrosbA Distilled water Fig. 3. Chromatography of recombinant TTR on a human RBP- Sepharose affinity column. Cultured Pichia producing recombinant human TTR was collected after induction for 4 days. Two milliliters of the supernatant were loaded onto a column of human RBP- Sepharose (1 mL of gel) equilibrated in 0.04 M Tris ⁄ HCl, pH 7.4 buf- fer containing 0.5 M NaCl. Bound protein was eluted with distilled water. The chromatographic separation was carried out at 4 °C. P. Prapunpoj et al. Function of transthyretin N-terminus FEBS Journal 273 (2006) 4013–4023 ª 2006 The Authors Journal compilation ª 2006 FEBS 4015 Mobility in SDS/PAGE The analysis in SDS ⁄ PAGE of purified recombinant human TTR and chimeric TTRs showed that the recombinant proteins have the relative mobility similar to those of TTRs from other vertebrate species (Fig. 4). The subunit molecular masses determined from the calibration curve were 17 kDa for all recombinant TTRs. The subunit masses obtained were similar to those of native TTRs from human and other vertebrates [14,21], indicating no aberrant post-transla- tional modification occurred with these recombinant TTRs. Mobility in nondenaturing gels Most TTRs from vertebrates including humans [22] and birds [12] migrate faster than albumin during elec- trophoresis at pH 8.6. Only for some eutherian species, such as pigs and cattle, TTRs comigrate with albumin in nondenaturing gels [23,24]. The mobilities of all recombinant TTRs in nondenaturing gel were greater than those of albumin and similar to TTR from human plasma (Fig. 5). Immunochemical cross-reactivity with antibodies against TTRs Immunochemical cross-reactivity of TTRs from several vertebrates is well known [13,14,25]. Two bands were observed in the test of the immunochemical cross-reac- tivity of each the recombinant TTR with antiserum raised against TTRs purified from serum of human, chicken and wallaby (Fig. 6). The major protein band, also detected by staining with Coomassie blue, was 97 66 45 30 20.1 14.4 M r (kDa) 3 A 2 1 M Fig. 4. Analysis by SDS ⁄ PAGE and determination of the size of the subunit of recombinant TTRs. Aliquots of purified (1) recombinant human TTR, (2) human ⁄ crocTTR, and (3) truncated crocTTR were boiled for 30 min in 2.5% 2-mercaptoethanol and 2% SDS, prior to analysis by SDS ⁄ PAGE. Proteins were stained with Coomassie blue. The positions of protein markers (M) are indicated. The sizes of the TTR subunits were obtained by comparison of electrophoretic mobility with protein markers, plotting the relative mobilities (R f ) against the logarithmic values of the markers. TTR HSA 3 2 1 HP Fig. 5. Electrophoretic mobility pattern of recombinant TTRs. The purified recombinant (1) human TTR, (2) human ⁄ crocTTR, and (3) truncated crocTTR were separated in a nondenaturing polyacryla- mide gel (10% resolving, 4% stacking). Protein bands were visualized by Coomassie blue staining. Human plasma (HP) was overloaded to show the human TTR (TTR). The position of serum albumin (HSA) is also indicated. M r (kDa) 14.4 21.1 30 45 67 94 Co oWest TTR monomer TTR dimer M1 2 312 3 Fig. 6. Cross-reactivity with antiserum against a mixture of TTRs. The purified recombinant human TTR (1), human ⁄ crocTTR (2), and truncated crocTTR (3) were analyzed by SDS ⁄ PAGE and electro- phoretically transferred to nitrocellulose membrane. The protein bands were stained with Coomassie (Coo) and identified by reac- tion with antiserum (West). The membrane filter was incubated with rabbit antiserum against a mixture of human, wallaby and chicken TTRs (1 : 5000) followed by anti-rabbit immunoglobulin (1 : 10000) conjugated with horseradish peroxidase. Detection was carried out by enhanced chemiluminescence. The positions of the TTR monomer and dimmer are indicated. Function of transthyretin N-terminus P. Prapunpoj et al. 4016 FEBS Journal 273 (2006) 4013–4023 ª 2006 The Authors Journal compilation ª 2006 FEBS found in the same position as that of the subunit of recombinant TTRs. Another band, barely visible, migrating more slowly, was found in a position corres- ponding to a molecular mass of about 30 kDa, consis- tent with being a dimer of TTR. Such dimers were always seen as faint bands when denaturation of TTR was not complete, even under conditions of harsh dena- turation [13,14]. Native molecular mass of the recombinant TTR tetramers TTRs purified from P. pastoris culture supernatant were analyzed by HPLC on a Bio-Sil SEC250 (Bio- Rad Laboratories, Inc., Hercules, CA, USA) column in 50 mm potassium phosphate buffer saline, pH 7.4. Proteins with known molecular masses were used to calibrate the column. In comparison to the standard curve, purified recombinant human TTR showed a molecular mass of 57 kDa, whereas human ⁄ crocTTR and truncated crocTTR had molecular masses of 63 and 57 kDa, respectively. These molecular masses were approximately four times the subunit mass for each TTR species. This strongly suggested that P. pastoris folded the TTR subunits correctly and that tetramer was correctly assembled. Binding affinities of recombinant TTRs to thyroid hormones The dissociation constants of the complex of the recombinant TTRs with thyroid hormones were deter- mined using the highly reproducible, rapid and sensi- tive method developed by Chang et al. [12]. The experiments were performed in triplicate for each hor- mone. Binding curves were plotted following the gen- eral equation according to Scatchard [25]. The K d values of chicken TTR derived from the Scatchard analysis and plots, both for T4 and for T3, were similar to those previously reported [14] (data not shown). Recombinant human TTR showed a higher affinity for T4 than for T3, and values similar to those reported for TTR from human serum [12]. The K d for T4 of the recombinant human TTR was 19.73 ± 0.13 nm and that for T3 was 53.26 ± 3.97 nm, giving a K d T3 ⁄ K d T4 ratio to 2.70 (Fig. 7A, B and G). The binding capacity of the recombinant TTR derived from the abscissa intercepts both for T4 and for T3 sugges- ted a capacity of two molecules of thyroid hormones per TTR molecule. In comparison, the recombinant chimeric TTRs, i.e. human ⁄ crocTTR and truncated crocTTR, possessed different binding affinities to T3 and T4, as well as K d T3 ⁄ K d T4 ratios. The human ⁄ crocTTR had K d values of 5.40 ± 0.25 nm and 22.75 ± 1.89 nm for T3 and T4, respectively, providing a K d T3 ⁄ K d T4 ratio of 0.24 (Fig. 7C, D and G). This ratio was higher than that reported for Crocodylus porosus TTR [14]. Because the K d for T3 of the human ⁄ crocTTR was not significantly different from that of C. porosus TTR (7.56 ± 0.84 nm) [14], the higher K d T3 ⁄ K d T4 ratio could indicate greater influence of the N-terminal change on binding to T4 than to T3. The K d values for both T3 and T4 of the truncated crocTTR were similar. Truncated crocTTR bound to T3 with a K d of 57.78 ± 5.65 nm and to T4 with a K d of 59.72 ± 3.38 nm (Fig. 7E,F and G), lead- ing to a K d T3 ⁄ K d T4 ratio to 0.97. For a summary of K d values and ratios, see Fig. 7G. Discussion The binding of thyroid hormones is one of the main functions of TTR, which is functionally integrated with albumin and thyroxine-binding globulin as a network system to ensure the appropriate extracellular and intracellular distribution of thyroid hormones. In the network, a deficiency in one component can be com- pensated for by the other components [6]. The affinities of T3 and T4 for TTRs from verteb- rate species vary considerably, in that TTRs from fish [11], amphibians [10,13], reptiles [14] and birds [12] bind T3 with higher affinity than T4, whereas TTRs from mammals bind T4 with higher affinity than T3 [12]. Paradoxically, the amino acids in the thyroid hor- mone binding sites of TTR that are involved with the interaction of TTR with the thyroid hormones are 100% conserved throughout vertebrate TTRs [26]. Examination of the alignment of TTR amino acid sequences from 20 vertebrate species revealed that the region of the subunit which changed in a distinct and directed manner was the N-terminal region. The ‘N-terminal region’ is defined as the amino acids from the N-terminus until the Cys residue which is the first to be unambiguously defined by electron density in X-ray crystal structures (Cys10 in human TTR) and considered part of the core structure of TTR. In gen- eral, the character of the N-terminal region of TTRs changed from longer (14 amino acids) and more hydrophobic to shorter (nine amino acids) and more hydrophilic (Fig. 8). These changes could be correlated with the change from preferential binding of T3 (N- terminal region that are longer and more hydrophobic) to preferential binding of T4 (N-terminal region that are shorter and more hydrophilic) [12]. Two N-ter- minal regions of TTR are located around each entrance to the central channel that contains the two P. Prapunpoj et al. Function of transthyretin N-terminus FEBS Journal 273 (2006) 4013–4023 ª 2006 The Authors Journal compilation ª 2006 FEBS 4017 thyroid hormone binding sites (Fig. 9) [18]. To the best of our knowledge, the only X-ray crystal structure demonstrating electron density for the N- and C-ter- minal regions is that of Hamilton et al. 1993 [18], and there have not been any direct structural analyses of the interaction of TTR N-terminal region with T3 or T4 directly. However, there are several indications in the literature that thyroid hormones interact with the N-terminal regions of TTR, e.g. Cheng et al. [27] dem- onstrated that N-bromoacetyl-l-T4 interacts with Gly1, Lys9 and Lys15 of human TTR; and the Gly6- Ser mutant of human TTR has a higher affinity for T4 than wild type TTR [28]. However, the synthesis of chimeric TTRs allowed to directly testing the hypothe- sis that the N-terminal regions of TTR affect the affinities of TTR for thyroid hormones. A previous study revealed that altering the structure of the N-ter- minal region influenced the affinity of thyroid hor- mones for TTR [14]. However, that study used a chimera of two species of TTR (X. laevis and C. poro- sus), both of which preferentially bound T3 over T4. Here, we tested that hypothesis that the structure of the N-terminal region influence the binding of T3 and T4 to TTR by comparing the affinities of T3 and T4 to 0 2 4 6 8 10 12 14 0 1020304050607080 0.0 0.5 1.0 1.5 2.0 2.5 3.0 0 5 10 15 20 25 30 35 40 45 50 0.0 0.1 0.2 0.3 0.4 0.5 0 5 10 15 20 25 0.0 0.1 0.2 0.3 0.4 0246810121416 0.0 0.5 1.0 1.5 2.0 2.5 3.0 0 5 10 15 20 25 30 35 40 45 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0 5 10 15 20 25 30 35 40 C D BA E F [bound T3], nM [bound T4], nM [bound T3], nM [bound T3], nM [bound T4], nM [bound T4], nM ]3T dnuob-RTT[ ]3T eerf[ ]4T dnuob-RTT[ ]4T e e rf[ ]3T dnuob-RTT[ ]3T eerf[ ]3T dnuob-RT T[ ]3T ee r f[ ]4T dnuob-RTT[ ]4T e er f [ ]4T dnuob-RTT[ ] 4 T e er f [ G Kd for T3 (nM) Kd for T4 (nM) KdT3/KdT4 Reference Human TTR 53.26 ± 3.97 19.73 ± 0.13 2.70 This paper Human/crocTTR 5.40 ± 0.25 22.75 ± 1.89 0.24 This paper Truncated crocTTR 57.78 ± 5.65 59.72 ± 3.38 0.97 This paper C. porosus TTR 7.56 ± 0.84 36.73 ± 2.38 0.21 Prapunpoj et al., 2002 Fig. 7. Binding of recombinant TTRs to thy- roid hormones. One hundred nanomoles of recombinant human TTR (A and B), human ⁄ crocTTR (C and D) and truncated crocTTR (E and F) were incubated with 125 I- T3 or 125 I-T4 in the presence of various con- centrations of unlabeled hormone at 4 °C, overnight. Free hormone was separated from the TTR-bound hormone by filtering the incubation mixture through a layer of methyl cellulose-coated charcoal under vacuum. All corrections including those for nonspecific binding were applied before per- forming the Scatchard analysis. The plots for the affinity (K d ), for T3 and T4 of the pro- teins were calculated and summarized (G). Function of transthyretin N-terminus P. Prapunpoj et al. 4018 FEBS Journal 273 (2006) 4013–4023 ª 2006 The Authors Journal compilation ª 2006 FEBS a TTR that has higher affinity for T4 (human TTR), a TTR that has higher affinity for T3 (crocodile TTR), and chimeric TTR consisting of the human TTR N-terminal region and the ‘rest of the molecule’ being crocodile TTR (human ⁄ croc TTR) and crocodile TTR without N-terminal region (truncated croc TTR). In vitro synthesis of TTR was desirable for two main reasons. Firstly, although the similarity of the phylo- genetic trees based on TTR structure and those based on morphological structure of animals suggest that the structure of TTR evolved under functional pressures providing an advantage in selection, it is difficult to quantitatively analyze in vivo details of the relationship between TTR structure and function using genetic alterations or specific inhibitors. The strong redundan- cies in the network of reactions involved in determin- ing thyroid hormone distribution, of which TTR is a part, renders the system so effective that a deficiency in one component is readily compensated in vivo by changes in the rest of the system. Second, the expres- sion of the TTR gene in some animal species some- times occurs in only one specific organ. TTR is only synthesized by the liver (and therefore can be purified from blood) of crocodiles during development in ovo and in hatchlings [3]. TTR is synthesized by adult cro- codile choroid plexus [14], but the volume of CSF required to be collected to enable purification of suffi- cient amounts of TTR for thyroid hormone binding assays renders this unfeasible. Therefore, to obtain suf- ficient amounts of TTR for further characterization, a heterologous gene expression system is needed. To determine the influence of the N-terminal region of TTR on the binding to thyroid hormones, the con- struction of chimeric recombinant TTRs containing variations in structure of the N-terminal region is desired. The functional properties (i.e. binding of T3 and T4) of such chimeric TTRs thus could be analyzed for providing insight into the relationship between structure and function. Fig. 8. Comparison of amino acid sequence of the N-terminal regions of vertebrate TTRs. Amino acid sequences in the N-terminal regions from six vertebrate species (human, Homo sapiens; sheep, Ovis aries; Tammar wallaby, Macropus eugenii; grey opossum, Monodelphis domestica; chicken, Gallus gallus domesticus; salt water crocodile, Crocodylus porosus; Xenopus, Xenopus laevis) are aligned with the amino acid sequence of human TTR. The sequence is written using the single-letter amino acid abbreviation. Asterisks indicate those resi- dues in other species with identical amino acids to those in human TTR. Gaps were introduced to aid alignment. Features of secondary structure of human TTR are indicated above the sequences. Numbering of residues is based on that for human TTR, and -a,-b,-c,-d and -e were introduced to indicate positions of residues in noneutherians. Double underlining indicates amino acid residues located in the central thyroid hormone binding site. For sources of the TTR sequences, see [13,16]. Fig. 9. X-ray crystal structure of human TTR dimer. Positions of N- and C-terminal regions located at the entrances of the central channel containing the thyroid hormone binding sites are indicated by pink and white arrows, respectively. Reprinted with permission of The American Society for Biochemistry and Molecular Biology, from [24]. Permission conveyed through Copyright Clearance Cen- tre, Inc. P. Prapunpoj et al. Function of transthyretin N-terminus FEBS Journal 273 (2006) 4013–4023 ª 2006 The Authors Journal compilation ª 2006 FEBS 4019 Recombinant TTRs were secreted into the culture medium, and purified TTRs migrated in SDS ⁄ PAGE as a single band with an approximate subunit molecu- lar mass of 17 kDa, similarly to TTR subunits from other vertebrate species. Immunochemical cross-reac- tivity with antibody against other TTRs confirmed that the bands of 15 kDa were TTRs. The electrophoretic mobility of recombinant TTRs in nondenaturing poly- acrylamide gel at pH 8.6 was faster than that of albu- min, which is a typical characteristic of TTR of most vertebrates found in nature [21]. Native TTR in plasma exists in the tetrameric form. The molecular masses of the recombinant proteins determined by gel filtration analysis were approxi- mately four times the mass of the subunit determined by SDS ⁄ PAGE, indicating that the recombinant TTRs as tetramers. Analysis of binding to retinol-binding protein and thyroid hormones showed that the recom- binant TTRs retained its function as binding protein for retinol-binding protein and thyroid hormones. In the present study, the K d values for T4 and T3 of all the recombinant TTRs were determined with the method described by Chang et al. [12]. Recombinant human TTR bound T4 with higher affinity than T3, similarly to that previous reported [12]. This confirmed that the recombinant TTR had folded into its proper native conformation. In the present study, we analyzed the binding of T3 and T4 to a chimeric TTR consisting of the N-terminal regions of crocTTR (which has higher affinity for T3) and the ‘rest of the molecule’ from human TTR (which has higher affinity for T4), and to truncated crocTTR (which lacked N-terminal regions). By this strategy, the result clearly indicated the involvement of the N-terminal region of TTR subunits in accessibility of thyroid hormones to the binding site, as well as the strength and binding preference of thyroid hormones to TTR. However, because the truncated crocTTR (lacking the N-terminal segment) had a K d T3 ⁄ K d T4 ratio of 1, this indicated that in the absence of N-ter- minal segment, TTR bound to both T3 and T4 with the same strength and preference. Comparison of the data in Fig. 7(G) reveals that, qualitatively, human ⁄ croc TTR is similar to croc TTR, in that they both have higher affinity for T3 than for T4. This could imply that the core of TTR is the main determinant of ligand affinity and than the N-terminal region exert a modulatory effect. However, truncated croc TTR has greatly reduced affinity for both T3 and T4 compared with either croc TTR or human ⁄ croc TTR. However, human ⁄ croc TTR has more similar T4 affinity to human TTR than croc TTR does, whereas the affinity of T3 was not greatly altered, implying that the N-terminal region exert a greater influence on the affinity of T4 than on the affinity of T3. This could imply that the core of TTR has a major influence in determining the affinity of T3 and the N-terminal region mainly influences the affinity of T4. To resolve this more precisely, further chimeric TTRs are required to be analyzed. Here, we have demonstrated that the character of the N-terminal region influences the binding of thyroid hormones to TTR. Taken together with our previous report [14], we propose that the N-terminal region has a role in determining the affinities of T3 and T4 to TTR. Experimental procedures Reagents and chemicals PCR and plasmid purification kits were from GibcoBRL (Long Island, NY, USA) and Qiagen (Hilden, Germany). ABI PRISM dye terminator cycle sequencing ready reaction kit with AmpliTaq DNA polymerase was from Perkin Elmer (Wellesley, MA, USA). DNA ligase was purchased from New England Biolabs (Ipswich, MA, USA). Restric- tion endonucleases and Taq DNA polymerase were from Promega (Madison, MI, USA) and Invitrogen (Carlsbad, CA, USA). Oligonucleotide primers were synthesized by GibcoBRL and the Bioservice unit, National Science and Technology Development Agency, Thailand. l-[ 125 I]-thyrox- ine (1.25 CiÆmg )1 ) and l-3,5,3¢-[ 125 I]-triiodothyronine (1.25 CiÆmg )1 ) were purchased from Dupont NEN (Boston, MA, USA), stored in lead containers and kept in the dark at 4 °C. Sep-Pak C-18 reversed-phase chromatography car- tridges were from Waters (Milford, MA, USA). A Bio-Sil SEC250 column and protein molecular weight markers were from Bio-Rad (Hercules, CA, USA). All other chemi- cals used were of analytical grade. Construction of expression vectors for recombinant human TTR Recombinant human TTR was first attempted to be syn- thesized using the pPIC9 vector, as this vector had been used for production of all other recombinant (including truncated and chimeric) TTRs. However, as this gave an extremely low yield, recombinant human TTR was then produced using the pPIC3.5 vector. BamH I and EcoRI sites were introduced by PCR into the human wild-type TTR cDNA, such that either cleavage by BamH I occurred immediately before the start codon ATG (for methionine) in the TTR cDNA presegment, or that cleavage by XhoI occurred immediately before the codon GGC of the first amino acid (Gly) of the mature TTR, and that cleavage by EcoRI occurred immediately after the stop codon TGA of Function of transthyretin N-terminus P. Prapunpoj et al. 4020 FEBS Journal 273 (2006) 4013–4023 ª 2006 The Authors Journal compilation ª 2006 FEBS the cDNA. Primers to generate the compatible restriction ends for ligation into the pPIC3.5 (using the TTR native secretion signal) and pPIC9 (using secretion signal of the a-factor) vectors are presented in Table 1. The PCR prod- uct with compatible restriction sites of BamHI at 5¢ and EcoRI at 3¢ ends was ligated to Pichia expression vector pPIC3.5 so that the newly synthesized TTR was secreted using its native presegment. The construct with XhoIat5¢ and EcoRI at 3¢ end was ligated into pPIC9, containing the a-factor peptide secretion signal for the recombinant pro- tein as described below. The inserted vector was linearized by digestion with Sal I and used for transformation of P. pastoris strain GS115 by electroporation. For both constructs in pPIC3.5 and pPIC9, screening of recombinant colonies with the methanol utilization positive (Mut + ) phenotype and induction synthesis of recombinant protein in the buffered glycerol-complex medium ⁄ buffered methanol-complex medium (BMGY ⁄ BMMY) were per- formed as described in the users’ manual (Invitrogen). The induction of 50 putative transformants with Mut + pheno- type was carried out in 0.5% methanol at 30 °C for 96 h. Construction of chimeric TTR cDNAs The human ⁄ crocTTR cDNA (cDNA that would code for residue Gly1 to Glu7 of human TTR and residues Ser8 to Glu127 of crocodile TTR) and truncated crocTTR cDNA (cDNA that would code for residue Ser8 to Glu127 of cro- codile TTR) were amplified using C. porosus TTR cDNA as the template. Pairs of specific primers (Table 1) were incorporated into the reaction mixture to alter the nucleo- tide sequence and generate XhoIat5¢ and EcoRI at 3¢ ends of the TTR template, as previously described [14]. The constructed cDNAs containing compatible restriction ends (XhoI and EcoRI ends) were ligated into Pichia expression vector pPIC9. The sequence Glu-Lys-Arg is necessary for a-factor peptide release by the KEX2 gene product, and cleavage by KEX2 occurs between arginine and glutamine in the sequence Glu-Lys-Arg-Glu-Ala-Glu-Ala. According to Invitrogen, the sequence of Glu-Ala-Glu-Ala is necessary for correct cleavage and will be removed during transloca- tion of the recombinant protein. Thus, the TTR cDNA was constructed such that the cDNA was immediately in-frame integrated with the coding portion of Glu-Ala-Glu-Ala. The vector construct was thereafter linearized with Sal I and introduced into P. pastoris. Screening of transformants and induction of synthesis of recombinant proteins were preformed as described for the recombinant human TTR. Each transformant showed a similar expression level of TTR (data not shown). One of each chimeric TTR trans- formant was used for further experiments. Purification of recombinant TTR from yeast culture supernatant The recombinant TTR was purified from the Pichia culture either by affinity chromatography using a human retinol- binding protein-Sepharose-4B as described by Larsson et al. [29] or by preparative discontinuous nondenaturing-PAGE using the Bio-Rad Prep Cell (model 491) (10% acrylamide for the resolving gel and 3% acrylamide for the stacking gel, and buffering system as recommended by the company). Determination of the masses of TTR tetramers by gel filtration Molecular masses of the recombinant human TTR, and chi- meric and truncated crocTTRs were estimated by HPLC ⁄ gel- permeation chromatography using Bio-Sil SEC250 column (Bio-Rad), equilibrated in 50 mm potassium phosphate buffer saline, pH 7.4. Aliquots (50 lL) of purified TTR (2 mgÆmL )1 ) were chromatographed and absorbance was measured at 280 nm. The column was calibrated with bovine serum albumin (68 kDa), ovalbumin (45 kDa), chymotrypsi- nogen (25.5 kDa) and ribonuclease A (13.7 kDa). Table 1. Oligonucleotides used to generate cDNAs for recombinant human TTR, human ⁄ crocTTR, and truncated crocTTR. PCR was per- formed with the oligonucleotides listed in a single step to generate cDNAs for recombinant human TTR and truncated crocTTR or in two steps to generate cDNA for recombinant human ⁄ crocTTR. Nucleotide sequence of human TTR in the primers is underlined, and that of C. porosus TTR is in bold. Species of TTR cDNA encoded Vector PCR step Sequence 5¢fi3¢ Sense Human TTR pPIC3.5 1 AGGATCCAGG ATGGCTTCTCATCG AGGAGTGAATTCTCA TTCCTTGGGATTGG Sense Antisense pPIC9 1 TCTCGAGAAAAGAGAGGCTGAAGCTG GCCCTACGGGG AGGAGTGAATTCTCA TTCCTTGGGATTGG Sense Antisense Human ⁄ crocTTR pPIC9 1 A ACGGGCACCGGTGAATCCAAATGCC ACGGAATTCTTATTCTTGTGGATCACTG Sense Antisense 2 CTCGAGAAAAGAGAGGCTGAAGCT GGCCCAACGGGCACCGG ACGGAATTCTTATTCTTGTGGATCACTG Sense Antisense Truncated crocTTR pPIC9 1 CTCGAGAAAAGATCCAAATGCCCACTTATGG ACGGAATTCTTATTCTTGTGGATCACTG Sense Antisense P. Prapunpoj et al. Function of transthyretin N-terminus FEBS Journal 273 (2006) 4013–4023 ª 2006 The Authors Journal compilation ª 2006 FEBS 4021 Analysis of N-terminal amino acid sequencing The N-terminal amino acid sequence of recombinant TTRs were determined using an automatic Edman degradation at La Trobe University, Australia, and at Bioservice Unit, National Science and Technology Development Agency, Thailand. Purification of radioiodinated thyroid hormones Commercially available l[ 125 I]-T3 and l[ 125 I]-T4 were separ- ated from free 125 I – and iodinated hormone degradation products using a SepPak C-18 cartridge column. Purifica- tion was checked by thin layer chromatography and ana- lyzed in an LKB 1270 Rackgamma II counter with a counting efficiency of 70%, as described previously [12]. Analysis of thyroid hormone binding to recombinant TTRs Purified TTR (100 nm) was incubated with T4 or T3 from 0 to 1000 nm, in Irvine buffer in the presence of tracer amounts of l[ 125 I]-T3 or l[ 125 I]-T4 at 4 °C, over- night, as described by Chang et al. [12]. Briefly, a volume of 0.4 mL of the incubation mixture was transferred to a vial for total radioactivity determination. Free T4 or T3 in 0.4 mL of the same incubation mixture was separated from the TTR-bound thyroid hormones within 1 s, by adsorption to a layer of methyl cellulose coated charcoal on a glass microfilter under constant vacuum. The filter was rinsed with 0.4 mL of Irvine buffer, then radioactiv- ity (corresponding to free thyroid hormone) in the filters was determined using an LKB 1270 Rackgamma II coun- ter with a counting efficiency of 70%. For analysis of K d values for T3 and T4 of all recombinant TTRs, analyses for chicken TTR purified from serum were always deter- mined simultaneously so that the same conformity of the assay system was confirmed and the K d values obtained could be compared. Nonspecific binding was extrapolated and other corrections were performed prior analysis by Scatchard plot [25]. SDS/PAGE Analysis of proteins under denaturing conditions was per- formed in SDS ⁄ PAGE slab gels (15% polyacrylamide, pH 8.6) using a 4% polyacrylamide stacking gel (pH 6.8) and the discontinuous buffer system of Laemmli and Favre [30]. Western analysis Western analysis was performed using a polyclonal anti- body from a rabbit raised against a mixture of TTRs purified from human, wallaby and chicken sera as the pri- mary antibody, as described previously [14]. The membrane filter was blocked, incubated with rabbit anti(human, wal- laby and chicken TTR) antiserum (1 : 5000), washed, then incubated with horseradish-peroxidase-conjugated anti-rab- bit immunoglobulin (1 : 10 000). Detection was carried out by enhanced chemiluminescence (Amersham, Pittsburgh, PA, USA). The filter was exposed to Kodak XAR-5 film with an intensifying screen at room temperature for 10 min, and then developed immediately. Acknowledgements This research was supported by grants from the Thai- land Research Fund (TRF), the National Research Council of Thailand and Prince of Songkla University (The Excellent Biochemistry Program Fund). References 1 Kabat EA, Landow H & Moore DH (1942) Electro- phoretic patterns of concentrated cerebrospinal fluid. Proc Soc Exp Biol Medical 49, 260–263. 2 Kabat EA, Moore DH & Landow H (1942) An electro- phoretic study of the protein components in cerebro- spinal fluid and their relationship to the serum proteins. J Clin Invest 21, 571–577. 3 Richardson SJ, Monk JA, Shepherdley CA, Ebbesson LO, Sin F, Power DM, Frappell PB & Ko ¨ hrle & Ren- free MB (2005) Developmentally regulated thyroid hor- mone distributor proteins in marsupials, reptile and fish. Am J Physiol 288, R1264–R1272. 4 Blake CCF, Geisow MJ, Oatley SJ, Re ´ rat B & Re ´ rat C (1978) Structure of prealbumin: secondary, tertiary and quaternary interactions determined by Fourier refine- ment at 1.8 A ˚ . J Mol Biol 121, 339–356. 5 Schreiber G, Prapunpoj P, Chang L, Richardson SJ, Aldred AR & Munro SLA (1998) Evolution of thyroid hormone distribution. Clin Expt Pharmacol Physiol 25, 728–732. 6 Schreiber G (2002) The evolutionary and integrative roles of transthyretin in thyroid hormone homeostasis. J Endocrinol 175, 61–73. 7 Pages RA, Robbins J & Edelhoch H (1973) Binding of thyroxine and thyroxine analogs to human serum pre- albumin. Biochemistry 12, 2773–2779. 8 Nilsson SF, Rask L & Peterson PA (1975) Studies on thyroid hormone-binding proteins. J Biol Chem 250, 8554–8563. 9 Wojtczak A, Cody V, Luft JR & Paugborn W (1996) Structure of human transthyretin complexed with thyr- oxine at 2.0 A ˚ resolution and 3¢,5¢-dinitro-N-acetyl-l- thyronine at 2.2 A ˚ resolution. Acta Crystallogr D52, 758–765. Function of transthyretin N-terminus P. Prapunpoj et al. 4022 FEBS Journal 273 (2006) 4013–4023 ª 2006 The Authors Journal compilation ª 2006 FEBS [...]... Parameters of thyroid function in serum of 16 selected vertebrate species: a study of PBI, serum T4, free T4, and the pattern of T4 and T3 binding to serum proteins Endocrinology 86, 793–805 25 Scatchard G (1949) The attractions of proteins for small molecules and ions Ann N Y Acad Sci 51, 660–672 26 Richardson SJ (2005) Expression of transthyretin in the choroid plexus: relationship to brain homeostatsis of. .. (1974) Structure of human plasma prealbumin at 2.5 A resolution A preliminary report on the polypeptide chain conformation, quaternary structure and thyroxine binding J Mol Biol 88, 1–12 18 Hamilton JA, Steinrauf LK, Braden BC, Liepnieks J, Benson MD, Holmgren G, Sandgren O & Steen L (1993) The X-ray crystal structure refinements of normal human transthyretin and the amyloidogenic Val-30?Met ˚ variant to. .. evolution Am J Physiol 283, R885–R896 15 Richardson SJ (2002) The evolution of transthyretin synthesis in vertebrate liver, in primitive eukaryotes and in bacteria Clin Chem Laboratory Med 40, 1191–1199 16 Prapunpoj P, Richardson SJ, Fumagalli L & Schreiber G (2000) The evolution of the thyroid hormone distributor protein transthyretin in the order Insectivora, class Mammalia Mol Biol Evol 17, 1199–1209... with increased thyroxine-binding affinity, characterized by DNA sequencing J Endocrinol 129, 309–313 29 Larsson M, Pettersson T & Carlstrom A (1985) Thyroid ¨ hormone binding in serum of 15 vertebrate species: isolation of thyroxine-binding globulin and pre-albumin analog Gen Comp Endocrinol 58, 360–375 30 Laemmli UK &Favre M (1973) Maturation of the head of bacteriophage T4 J Mol Biol 80, 575–599 31... Purification and characterization of a 3,5,3¢-l-triiodothyronine-specific binding protein from bullfrog tadpole plasma: a homolog of mammalian transthyretin Endocrinology 132, 2254–2261 11 Santos CRA & Power DM (1999) Identification of transthyretin in fish (Sparus aurata): cDNA cloning and characterisation Endocrinology 140, 2430–2433 12 Chang L, Munro SLA, Richardson SJ & Schreiber G (1999) Evolution of thyroid... (1994) Evolution of marsupial and other vertebrate thyroxine-binding plasma proteins Am J Physiol 266, R1359–R1360 22 Seibert FB & Nelson JW (1942) Electrophoretic study of the blood protein response in tuberculosis J Biol Chem 143, 29–38 23 Farer LS, Robbins J, Blumberg BS & Rall JE (1962) Thyroxine serum protein complexes in various animals Endocrinology 70, 686–696 24 Refetoff S, Robin NI & Fang VS... thyroid hormone binding by transthyretins in birds and mammals Eur J Biochem 259, 534–542 13 Prapunpoj P, Yamauchi K, Nishiyama N, Richardson SJ & Schreiber G (2000) Evolution of structure, ontogeny of gene expression, and function of Xenopus laevis transthyretin Am J Physiol 279, R2026–R2041 14 Prapunpoj P, Richardson SJ & Schreiber G (2002) Crocodile transthyretin: structure, function, and evolution... hormones In The Blood–Cerebrospinal Fluid Barrier (Zheng, W & Chodobski, A, eds), pp 275–304 CRC Press, Boca Raton 27 Cheng SY, Wilchek M, Cahnmmann HJ & Robbins J (1977) Affinity labeling of human serum prealbumin with N-bromoacetyl-l-thyroxine J Biol Chem 252, 6076–6081 28 Fitch NJS, Akbari MT & Ramsden DB (1991) An inherited non-amyloidogenic transthyretin variant, [Ser6]-TTR, with increased thyroxine-binding... bacteriophage T4 J Mol Biol 80, 575–599 31 Aldred AR, Prapunpoj P & Schreiber G (1997) Evolution of shorter and more hydrophilic transthyretin N-termini by stepwise conversion of exon 2 into intron 1 sequences (shifting the 3¢ splice site of intron 1) Eur J Biochem 246, 401–409 FEBS Journal 273 (2006) 4013–4023 ª 2006 The Authors Journal compilation ª 2006 FEBS 4023 ... variant to 1.7-A resolution J Biol Chem 268, 2416– 2424 19 Hamilton JA & Benson MD (2001) Transthyretin: a review from a structural perspective Cell Mol Life Sci 58, 1491–1521 20 Cereghino JL & Cregg JM (2000) Heterologous protein expression in the methylotrophic yeast Pichia pastoris FEMS Microbiol Rev 24, 45–66 Function of transthyretin N-terminus 21 Richardson SJ, Bradley AJ, Duan W, Wettenhall REH, . Change in structure of the N-terminal region of transthyretin produces change in affinity of transthyretin to T4 and T3 Porntip Prapunpoj 1 ,. on the affinity of T4 than on the affinity of T3. This could imply that the core of TTR has a major in uence in determining the affinity of T3 and the N-terminal region