by the end of the lesson ss will be able to decide and explain the activities talk about what they will prepare buy and do they may prepare before a typhoon
Giáo án Anh văn lớp 7 : Tên bài dạy : People and places. Lesson 3: B1 - 2. I.Ojectives : -After the lesson Ss will be able to know more docx
... -Ask Ss retell the name of some countries in the south-east Asia -Work in pairs to discuss and write the answers on the BB Thai land - Laos - Cambodia - Singapore - Indonesia Malaysia ... pairs) *Production -Ask Ss to retell some things about the General Nguyen Van Giap -Work in pairs to discuss -Speak aloud before the class Consolidation: -Ask Ss to retell the main content of ... *Practice - Play the tape again and then read the text to the exercise True- False - Give the correct answers a) False ( Liz knows nothing about General Giap.) b) False ( The People Army of Vietnam...
- 4
- 654
- 1
Unit 3: At home.Period 17: Lesson 4: ReadI. Objectives: - After the lesson, Ss will be able to pptx
... questions - Ask Ss to give their answers by both only and in writing - Give answers: a Because children often try to eat and drink them b Because the kitchen is a dangerous place c Because playing ... Reading the text - Ss read the text and check their prediction - Ask Ss to correct if the statements are false b, Comprehension questions: - Ask Ss to work in pairs to find out the answers of the ... Slap the board - Ask Ss to read the statements and guess which is true, which is false - Give T/F statements prediction basing on the part in textbook - Give feedback * While- reading: a Reading...
- 4
- 345
- 0
the method of investment appraisal which may be applied to evaluated and rank potential investment opportunities and their relative merits and limitations
... share, because it allows them to have advantage in price competitive The acquisition of a large competitor is a reasonable way to quickly attain significant market share • Production capacity The buyer ... knowledge base that gives a company a competitive advantage, and is one of the best reasons to acquire a company • International alternative A company may have an extremely difficult time creating ... growth is attained (international business and management) II- The method of investment appraisal which may be applied to evaluated and rank potential investment opportunities and their relative...
- 17
- 575
- 0
Ethnicity, society and religion the spread of sanshan guowang cult from eastern guangdong to singapore and malaysia
... Abdul Rahman (Malaysia) With their timely assistance, I was able to access and collect a wealth of materials and relevant research data for my study I would also like to acknowledge all the administration ... Township, Taiwan, the Feng Guo Fen Yang Association in Singapore and various other temples in Peak, Kuala Lumpur and Sarawak, Malaysia I am grateful for the support rendered by my classmates and friends ... cult of Sanshan Guowang from their homeland in Southeast China to Singapore and Malaysia The main purpose of my study is to analyze the historical development of the Sanshan Guowang belief and...
- 230
- 1,691
- 0
INDUSTRY SURVEY - What future animators say about what they are looking for in a school, and what professional animators say are the most important things to look for. ppt
... important to advancing your education as a professional animator They also state the importance of creating and maintaining a professional network One in five animators say they have a mentor at ... ANIMATORS SAY IS IMPORTANT ABOUT GETTING A GOOD ANIMATION EDUCATION We asked professional animators about the type of education they got and what they thought was most important to getting started ... SURVEY What future animators say about what they are looking for in a school, and what professional animators say are the most important things to look for Quotes throughout are from professional animators...
- 14
- 465
- 0
Will be able to yacon extract produce positive changes to life
... tend to be part of relation to overall experience? The individuals haven't been successful, yet, and it is because they give-up and usually at the start of the process Harsh diets and the so-called ... on the end goal An alternative form of research has established that people who keep a positive concentrate on their overall goal tend to achieve them What so many people want to lose weight tend ... your particular Yacon root product the opportunity to its work And you really need to visit a certain amount of standard as you take it To illustrate - you will observe a lessing of daily appetite...
- 2
- 399
- 0
báo cáo khoa học: " Transcriptomic identification of candidate genes involved in sunflower responses to chilling and salt stresses based on cDNA microarray analysis" pps
... TGATCCATCAATCTCCGTCTT AAAGGATCAGTCGCTGCTGT CAAAATGCAACGACCCATTA CAACAAAAGCAGACGCTGAA CAGCCCGGAGAGGTTTAACT AATCCCATCAATCCCCACTT GCCGAGGTACAAACTGGAGA ACGGAAGCGTTGTTTGGTAA CAGAGACGTTCTTGCGTTGA CGCAATTGCTATTGATGGAA ACGCGAGTCGGTTGTTTTAT ... TGAGCATGATCTGAATATCTTGAA TCAACATCCCACAGAAACGA CGCACACAACAAAGAAATGG ACACCGGTATGGTTGATGCT TCATTTTCTCCACCCATGGTA GAGGTTCATTCCGTCGTTGT GTGACCCGAACTCCTTGGTA CGACTCCGCCAAATACAGAT AACTTTGCAGTGGGACCATC GGCAGGTACATCTTGGCCAAT ... ACGCGAGTCGGTTGTTTTAT GGCAGGTACCAGGGGTTATT TTTGCAAGGATGAATGGTGA GGCAGCCAATCCTCTTGATA TTCAGCCCGGAAAGAATATG GGAACACCGTGAAGGATGAG CTCACGAAAGCTTCCTGCTT AAGACGGTGGATTTGAGGTG GGCAAGGGAAAACACCACTA AGGGCGGTCTTTCCAAGTAT...
- 18
- 493
- 0
PURIFICATION OF SIMPL ANTIBODY AND IMMUNOFLUORESCENCE OF SIMPL SUB-CELLULAR LOCALIZATION IN RESPONSE TO TNFα- AND IL-1
... isolate the targeted antibodies The antigen is coupled to what will make up the column bed and act as the stationary phase and the solution containing the antibody of interest will act as the mobile ... and it is known to have an impact on cell adhesion and cell migration (Cardoso and Oliveira 2003; Pham et al 2003; Takeuchi and Baichwal 1995) Aberrations in its activation have been linked to ... its lack of exposure to a wide range of antigens If the animal has been exposed to other antigens, then contamination of the polyclonal antibody can occur as well as cross reactivity Also, ideally...
- 63
- 162
- 0
Period 8 UNIT 2: CLOTHING Lesson 2: Speaking I. Aims of the lesson : By the end of the lesson Ss pot
... 9–i and match them with the at the pictures phrases Remember the - Ask Ss to work in pairs phrases then write - Checks: Kim’s game down on the board - Asks Ss to remember the phrases on page ... wear these ss wear about the wearing Questions name items note of what you usually wear clothes on the weekend clothes? - Because What is your favorite type of the clothing? Why you wear these ... usually 10 Ss each to read and write and write more wear on the weekend? more questions for the last questions for the last - I usually wear section of the survey about what section of the survey...
- 4
- 393
- 0
Period 9 UNIT 2: CLOTHING Lesson 3: Listening I. Aims of the lesson : - By the end of the lesson, potx
... last What s she like? seen near the Answer: main entrance to She is three the Car Fair She was last seen She has short near the main entrance dark hair to the Car Fair She has short dark Ask ss ... questions answer the ? What are these? questions ? What is this? These are ? What color is this? This is ? What color are these? This is - Set the scene : You will hear an These are announcement about ... Listen to the *Answer the question - Ask Ss to listen to the tape and tape to check the How old is she? check the answers answers Where was she last Feed back - evaluation She is three seen? She was...
- 4
- 975
- 4
Period 10 UNIT 2: CLOTHING Lesson 4: Reading A. Teaching points: By the end of the lesson , pot
... jeans at last 3-Because become high fashion clothing? became cheaper Why did the sale of jeans 4-Jeans at last became stop growing? high fashion clothing in jeans the 1980 5 -The sale of jeans ... discuss the question material that was made What was the 60 s’ fashion? in Europe Why old more and more 2 -The people begin wearing in the were embroidered jeans 60’ fashions 1970? painted jeans and ... reading: Reading -Asks Ss to read the text to -Read the text to check *Gap fill check their answers the answers * Gap fill 18 century 1960s students - Asks Ss to read the text Read the text to fill...
- 5
- 511
- 0
UNIT 1 : A VISIT FROM A PEN PAL Lesson 2: Speak and Listen I. Aims of the lesson : By the end of pot
... and ? Where are they going to flowers beautiful? go? What can they on ? What are they doing to do? Listen to the dialogue and Ocean Drive? ? How they get there? check their predition 3 .What are ... the scene: "Tim John' s Mexican pen pal, Carlos is visiting the USA" *They are going to park ? Look at the pictures to *They are *Question given: guess the answering *They an get there Are the ... check Ss understanding * Yes ? Have Nga and Maryam met - VN people are very each other before? friendly and HN is a very ? Is Maryam enjoying her interesting city stay in HN? 5.b ? What does...
- 5
- 862
- 0
Giáo án Tiếng Anh lớp 8: Unit 6 The young pioneers club Lesson 2 : Speak A/ Aims and Objectives : By the end of the lesson , pps
... make the dialogue and move around the class and help Ss - Call on some Ss to practice the dialogue in front of the class V / Homework : Learn by heart the expressions to offer assistance and favor ... chorally and then individually all the phrases in the chart Closed pairs III / Practice : Ask Ss to work in pairs to practice the dialogues - Call on some pairs to practice in front of class - Correct ... ? May I help you ? + What is for ? For offering assistance + another way to offer assistance ? Do you need any help ? / Let me help you + How you say to respond to assistance ? Yes No , thank...
- 6
- 6,310
- 13
Physics of the Future: How Science Will Shape Human Destiny and Our Daily Lives by the Year 2100
... bolts and plagues were thought to be the work of the gods We have a great advantage that Verne and Leonardo da Vinci did not have: a solid understanding of the laws of nature Predictions will always ... wishes Today, we have become choreographers of the dance of nature, able to tweak the laws of nature here and there But by 2100, we will make the transition to being masters of nature 2100: BECOMING ... built a cloud chamber with a powerful magnetic field and photographed tracks of antimatter But photographing antimatter was not enough My goal now was to produce a beam of antimatter The atom smasher’s...
- 1,093
- 2,186
- 0
Period 7 UNIT 2: CLOTHING Lesson1: Getting started, Listen and read I. Aims of the lesson : By the potx
... 3 .They added these patterns 2 .The ao dai is worn by women to the ao dai nowadays 4 .They make the ao dai from 3 .The ao dai is added these silk patterns 4 .The ao dai is made from silk Further practice ... drill: They modernize the ao Change the sentences in to dai nowadays Change the passive voice 2.Nowaday, only women sentences in to 1 .The ao dai is modernized wear ao dai passive voice nowadays 3 .They ... Women wear Ao dai Yes Ao dai is worn by the So I can say “ Ao dai is women worn by the women” and Active: S + V + this is the passive form of O Passive: S +to be + PP +( by “women wear ao dai” +O)...
- 6
- 3,083
- 1
Giáo án lets go 1 - UNIT 3: LET’S LEARN Week: 21 Period: 42 I. Objectives: By the end of the ppt
... case 6’ - Show on the What are these? They re pencil Sam and case Playing Ginger What s this? It’s a table the tape What are these? They re tables - Listen and What s this? It’s a cassette What ... What are these? They re choral cassettes repetition What s this? It’s a marker What are these? They re markes Playing What s this? It’s a notebook the tape What are these? They re notebooks again ... Listen and choral repetition Asking groups a crayon, crayons; a pencil case, pencil cases; a table, tables; ask and a cassette, cassettes; a marker, markers; a notebook, notebooks.answer Vocabulary...
- 7
- 456
- 0
Unit 14: Wonders of the World. Period 89– Lesson 5: WriteI. Objectives: -After the lesson Ss docx
... Ask Ss to exercise in the work book (Page 85)? New lesson: A Warm up - Ask Ss to play the net work About the World Heritages side - The Great wall in China - The great Pyramids - The leaning ... ss to read the letter again and write the letter to friend to retell your friend about the famous place -Ss have to use the information below: Place: Distances from your city: How to get there: ... it What you plan to the summer vacation? Write to me soon Your friend, Hoa D Post –writing -Ask Ss to read the other letters that they have written Consolidation: - Ask Ss to retell the main...
- 5
- 696
- 0
End of the Tether
... coastwise cargo here and there, and finishing with a hundred miles' steady steaming through the maze of an archipelago of small islands up to a large native town at the end of the beat There was ... 91 Chapter For a long time after the course of the steamer Sofala had been altered for the land, the low swampy coast had retained its appearance of a mere smudge of darkness beyond a belt of glitter ... order and its sights and its people Malacca to begin with, in at daylight and out at dusk, to cross over with a rigid phosphorescent wake this highway of the Far East Darkness and gleams on the water,...
- 11
- 393
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25