... Vietnam National University viii Part A: Introduction Rationale There is no denying that English is becoming a dominant language over the past few years, especially inthe context of globalization ... objectives ofthe supplementary reading syllabus Based onthe main objectives ofthe syllabus, the advantages and disadvantages of each syllabus type, the background ofthe target learners as well as the ... no acknowledgement to factors which are needed inthe creation of any course Finally, the language-centered analysis of target situation data is often at the surface level, taking little account...
... protein isoforms (LAP1 and 2) contain a region of homology called the LAP-Emerin-MAN1 (LEM) domain; (residues 2–45 in human emerin) This domain is PKA phosphorylates emerin involved in binding to ... partly, through its interaction with lamin A ⁄ C The nucleoplasmic domain of emerin and the equivalent domains of two other inner nuclear membrane proteins termed MAN1 and the lamina-associated ... peak at 23 625 Da is nonphosphorylated and each subsequent peak increases by an increment of 80 Da corresponding withthe molecular mass of an additional phosphate group The y axis is an arbitrary...
... cancer isa highly metastatic disease characterized by widespread intraperitoneal dissemination of tumor cells and ascites formation The intraperitoneal dissemination of ovarian tumor cells involves ... 1:1223-1232 Abdollahi T, Robertson NM, Abdollahi A, Litwack G: Identification of interleukin as an inhibitor of tumor necrosis factor-related apoptosisinducing ligand-induced apoptosis inthe ovarian carcinoma ... including migration, survival in peritoneal fluids, invasion and proliferation Our data show that the prosurvival activity of ascites against TRAIL is associated witha shorter disease-free interval...
... especially concerning remiges and rectrices At one day of age, the primary and secondary feathers are like coverts ina slow feathering chick, and at eight days they not have tails Owing tothe considerable ... considerable power of thermal insulation ofthe plumage, this phenomenon may favour heat dissipation towards the environment and thus have an in uence on traits of economic importance: food intake, ... weeks of age Plumage weight was calculated as an absolute value and per cent of body weight, as for males in individual cages 2.4 Statistical analysis Analysis of variance with unequal subclass...
... asymptotically normal Following a classical theorem in asymptotic theory (see for instance, formula 6a. 23, page 386 in Rao, 1973) and knowing that: is also one has, given Assuming toa i a as in section ... appealing for practitioners This is especially clear as far as ETA’s are concerned and one may alternatively to tt consider as a sire evaluation, the expectation of !r = !(!) with , * respect tothe ... the distribution in (4b) can be viewed as a function of n, 7r and A that is, conditional on n, !6 and the , ? , b distribution of is: r = with expectation and variance Probability statements about...
... •• •• Marian Affarah Marcella Alsan Ala Alwan Ana Mar a Amaris Islene Araujo de Carvalho Martha del Socorro Arias Novoa Larry Bagley Emily Bahnsen Anna Barker Matthew Basilico Janine Barnaby John ... Ministry of Health of Mexico Ministry of Health of Rwanda Ministry of Health ofthe State of Jalisco Ministry of Heath ofthe State of Morelos Ministry of Health ofthe State of Nuevo León National ... Government of Rwanda and Partners in Health This isa concrete example of how collaboration and international partnerships are at the core of achieving any success against cancer Cancer, a disease plagued...
... right information about their activities and performance is essential to making good business decisions The Information Centre has a wide range of company databases that can provide financials, ... specialises in providing up to date, authoritative financial analysis They publish in- depth industry reports and market analysis on over 1500 UK industries The following isa sample ofthe reports ... analysis and forecasting based on primary quantitative and qualitative research, providing the full picture ona particular industry, issue or trend The following isa sample ofthe reports available...
... BPTI Bovine pancreatic trypsin inhibitor 10 10 Biochemical Abbreviations A Adenine Alanine or alanyl aa Amino acid aaRS Aminoacyl-tRNA ACAT Acyl-CoA:cholesterol acyltransferase ACES N-(2-Acetamido)-2aminoethanesulfonic ... elongation is occurring Indeed, if Atotal isthe total monomer concentration at the beginning of elongation, then the rate of spontaneous nucleation will be proportional tothe third power of Atotal ... moderate concentrations of mineral acids The value and sign of ⌽ isa measure ofthe response ofthe acid-base equilibria to changes in acid concentration An analogous equation for kinetic data is log...
... Sciences Other participating institutions in Tanzania include the MOH, the National AIDS Control Program (NACP) and the Tanzania Food and Drug Administration (TFDA) In Rwanda, the RTRC is based at the ... countries Other countries, including Ghana, Liberia and Namibia, have since adapted these materials for local use Training on HIV/AIDS pharmaceutical management In Uganda and Tanzania the RTRC has been ... Collaboration for Pharmaceutical Management concept The Regional Technical Resource Collaboration for Pharmaceutical Management concept Regional coordination and technical assistance Regionally,...
... plants inoculated withthe replicating mutants that had variable symptoms (Y33 0A, C33 5A, D36 3A, and P39 9A) All four ofthe mutations were stably maintained For example the alanine residue is maintained ... this region are indicated onthe left and the virus abbreviations are defined inthe Methods The amino acids are given in single-letter code Alanine-scanning mutagenesis was targeted to ten amino ... CACACCCTGTAGAGGGCTCTCCAG CCTTTCTTATCAGCCACCCTGTAGAG GGAATACAGCTGGCAAGGC TGATCCTGGGCGTATGCGC GCCCCAACTAATGCATTGGTCACTAG CCAAGCAGTCGCATTGGCCCC aThe altered nucleotides onthe PMV cDNA are underlined...
... simulation The speed ofthe architecture is increased by utilizing a multiple memory bank approach to allow parallel access tothe neighbourhood pixel values This approach has the advantage of allowing ... Spartan-3 FPGA Section summarizes this paper The Watershed Algorithm Based on Rainfall Simulation The watershed transformation is based on visualizing an image in three dimensions: two spatial ... image has regions where the pixels have the same value and are not a regional minimum, they are called nonminima plateaus The nonminima plateaus are a group of pixels which can be divided into...
... spaces,” Journal of Mathematical Analysis and Applications, vol 299, no 2, pp 651–662, 2004 24 X Wang and J G Si, “Differentiable solutions of an iterative functional equation,” Aequationes Mathematicae, ... Kulczycki and Tabor 22 investigated iterative functional equations inthe ˙ class of Lipschitz functions In 2004, Tabor and Zołdak 23 studied the iterative equations in Banach spaces Inthe above ... problem of differentiable solutions of iterative equations has also fascinated many scholars’ attentions In Zhang 16 and Si 19 , the C1 and C2 solutions of 1.1 are considered In Wang and Si 24 , the...
... MIMO capacity Optimal power allocation with PARC Equal power allocation with PARC Suboptimal power allocation with PARC Equal power & rate allocation (MMSE V-BLAST) MIMO capacity Optimal power allocation ... the average capacity is calculated assuming that a scalar capacity-achieving code is used: Γ = at (1) First, the effect of rate quantization is investigated; later, power quantization is also considered ... combination, the following cases are depicted: MIMO capacity, optimal power allocation with PARC, equal power allocation with PARC, suboptimal power allocation with PARC, and equal power and equal rate allocation...
... during meiosis allows a mixing ofthe genetic material The recombination index (RI) calculated (RI n + TC, where n isthe number of bivalents and TC the total number of chiasmatas) is 90-100 in birds, ... to disappear completely in mammals [68] According to Rodionov [68], it might be tempting to consider them as ancestral chromosomes although they are very rare in fish and batracians Indeed, they ... Myakoshina Y.U., Chelysheva L .A. , Solovei LV., Gaginskaya E.P., Chiasmata on lampbrush chromosomes of Gallus gallus domesticus Cytogenetic investigations of recombination frequency and linkage group...
... method is non-linear and approximates the best predictor ina squared error Theoretical objections arising in analysis of categorical data with linear models , IANOLA (e.g., G 1982) are eliminated ... Similarly where p! ! isthe fraction ofthe residual variance ofthe underlying variable explained a linear relationship with e and e Since the unit of measurement inthe conditional , ; ;2 distribution ... was adapted tothe situation where the probability of « response» isa function of continuous « riskvariables Also, consideration is given tothe assumption that candidates for selection are sampled...
... pain did not respond tothe radiotherapy and has remained the main issue At 10 months after her initial presentation, an examination under anesthesia (EUA) and cystoscopy was performed Operative ... PEComa is made onthe basis of histological and immunohistochemical findings Basic characteristic features of perivascular epithelioid cells include abundant clear to eosinophilic granular cytoplasm ... production At a Page of cellular level, it inhibits the activation ofthe mammalian target of rapamycin (mTOR), a key regulatory kinase, leading to suppression of cytokine-driven T cell proliferation and...
... connective tissue and autoimmune diseases and human adjuvant disease [4, 8, 9] At present, the mechanism of such complications is uncertain and in some cases, proof of such a relationship remains ... continued leakage through an intact surface [1,3,4,6,8] The risk of rupture and/or leakage increases with increasing age ofthe implant, the site of implantation (retroglandular as opposed to ... favourable The rationale for this is that silicone granulomata have been found as incidental findings in axillary nodes removed at mastectomy for breast cancer inthe presence of intact breast prostheses...