and two photon fluorescence excitation two photon excitation results from the simultaneous absorption of two low energy photons by a fluorophore
Báo cáo khoa học: " Impact and relationship of anterior commissure and time-dose factor on the local control of T1N0 glottic cancer treated by 6 MV photon" doc
... carcinoma - patterns of failure and salvage treatment after curative radiotherapy in 861 consecutive patients Radiotherapy and Oncology 2002, 63:257-267 Yamazaki H, Nishiyama K, Tanaka E, et al: Radiotherapy ... http://www.ro-journal.com/content/6/1/53 Page of Table Univariate and multivariate analysis of factors affecting local control Parameters Events/ patients Uni-variate analysis Table Category- A: grouping according ... univariate and multivariate analysis to determine the hazard ratios and significance of potential risk factors for local control (LC) All statistical tests were two- sided and performed at the...
- 9
- 361
- 0
Tài liệu Báo cáo khoa học: Different modes of dipeptidyl peptidase IV (CD26) inhibition by oligopeptides derived from the N-terminus of HIV-1 Tat indicate at least two inhibitor binding sites doc
... backbone carbonyl group of Val4 of the peptide and the backbone amide hydrogen of Ala743 of the enzyme, between the side chain carbonyl group of Asn7 of Tat(1–9) and the side chain of Lys554 of ... differs by the factor a The Ki values of the inhibition of DP IV by these oligopeptides were in the micromolar range and the a values were in a range between 9.4 and 16 (Table 1) indicating a greater ... of the side chain carboxylic group of Glu668 and between the carbonyl carbon atom of Pro of the substrate Ala-Pro-pNA and the Ser630 oxygen atom of the enzyme to hold the substrate inside the active...
- 10
- 505
- 0
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc
... containing 100 lm of (GlcNAc)14 was analysed at the start, in the middle and at the end of each series of samples The resulting average values of the standards (displaying standard deviations of < 5%) ... regular time intervals The degradation of a- chitin by LlChi1 8A started with a rapid phase, regardless of the presence of LlCBP3 3A In the presence of LlCBP3 3A, the fast initial phase was maintained ... instructions, containing ends compatible with the expression vector (forward primer, 5Â-GGTATTGAGGGTCGCCATGGTTATGTTC AATCACCA-3Â; reverse primer, 5Â-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3Â) The PCR product...
- 14
- 683
- 0
Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf
... tyrosine kinases participates in growth regulation of human breast carcinoma cells Oncogene 20, 2499–2513 Kanda N, Seno H, Konda Y, Marusawa H, Kanai M, Nakajima T, Kawashima T, Nanakin A, Sawabu T, ... STAT1 The actions of STAT3 and STAT1 are highly entangled, they also have antagonistic activities, and they regulate each others activity Thus, the inhibition of both factors in vivo may have unpredictible ... which was derived from the seruminducible element of the human c-fos promoter, and RHN(CH2)6- CATTTCCCTTAAATCGAAGATTTAAG GGAAATG-(CH2)3NHR (mutated hairpin control ODN) (Sigma-Proligo; Sigma-Aldrich...
- 11
- 558
- 0
Tài liệu Orthodontists and patient´s aesthetic perception to different types of profi les modifi ed by a computer program pdf
... position of the lower jaw to a greater extent than the position of the upper jaw in cases of upper and lower jaw surgery Another obvious fact was that male profile with bimaxillary protrusion was not ... and F5 (normal profile) represented Mexican profiles with skeletal Class basal relation and incisor Class with average of cephalometric normal values These were used as templates from which the ... their respective lateral cephalometries were used to generate another manipulated images In these created images, hard tissue normal values were altered in at least two standard deviations Facial...
- 7
- 708
- 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... GCCAGCCCCCTGATGGGGGCGA AAATAATACGACTCACTATAGGCATTGAGCGGGTTTATCC GCCAGCCCCCTGATGGGGGCGA AAATAATACGACTCACTATAGACACTCATACTAACGCCATG GCCAGCCCCCTGATGGGGGCGA AAATAATACGACTCACTATAGCCGGCTGGACTTGTCCGG GGAGCCACCATTAAAGAAGGG ... GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT AGCCATGGTTT AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC ... TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA TAATACGACTCACTATAGGGGCACGCCCAAATCTC GCCAGCCCCCTGATGGGGGCGA...
- 15
- 597
- 0
Adolescent Sexual and Reproductive Health in Malawi: Results from the 2004 National Survey of Adolescents pdf
... Social Research, Zomba, Malawi, James Kaphuka, the National Statistical Office, Zomba, Malawi; and Dixie MaluwaBanda, University of Malawi, Chancellor College, Zomba, Malawi The authors thank their ... health Malawi: Political and Historical Background Malawi is a small landlocked country located in southeast Africa and shares its boundary with Mozambique, Zambia and Tanzania The country was ... (Uganda); Kofi Awusabo-Asare and Akwasi Kumi-Kyereme, University of Cape Coast (Ghana); Alex Ezeh, African Population and Health Research Center (Kenya); and Pav Govindasamy, Albert Themme, Jeanne...
- 152
- 657
- 0
Trends in the European Investment Fund Industry in the Second Quarter of 2011 and Results for the First Half of 2011 potx
... 174 UCITS types Equity Balanced Total Equity & Balanced Funds of funds (4) Other Total (excl Ireland & Netherlands) of w hich guaranteed funds Total (incl Ireland & Netherlands) 36,733 in No in ... drop was mainly attributable to large outflows from money market funds, as well as concerns regarding the strength of the global economic recovery and increasing tensions in the euro area, which ... in net sales of UCITS in April and May following the Japanese earthquake in March was short-lived This can be seen from the trends in monthly net sales for UCITS, which shows a sharp turnaround...
- 8
- 637
- 0
Trends in the European Investment Fund Industry in the Second Quarter of 2012 and Results for the First Half of 2012 pdf
... Total Equity & Balanced Funds of funds (4) Other Total (excl Ireland & Netherlands) of w hich guaranteed funds Total (incl Ireland & Netherlands) 35,766 (1 No full data breakdo wn is available ... r EFA M A members fo r which data are available ) EFAMA Quarterly Statistical Release N°50 (Second Quarter of 2012) Trends in the European Investment Fund Industry Net Assets by Country of Domiciliation ... r EFA M A members fo r which data are available; (2) including funds o f funds, except fo r France, Germany and Italy fo r which the funds o f funds data are ) included in the o ther fund catego...
- 8
- 663
- 0
Báo cáo Y học: Modulation of the oligomeric structures of HIV-1 retroviral enzymes by synthetic peptides and small molecules pptx
... capacity to dramatically increase the association of the p66 and p51 RT subunits [58] Using a yeast two hybrid RT dimerization assay that specifically detects the interaction between the p66 and ... Craigie, R (1991) HIV-1 DNA integration: Mechanism of viral DNA cleavage and DNA strand transfer Cell 67, 1211–1221 62 Asante-Appiah, E & Skalka, A. M (1999) HIV-1 integrase: Structural organization, ... intrinsically asymmetric Thermodynamic evaluations of the association between the p66 and p51 subunits of RT have estimated a Gibbs free energy of dimer stabilization of approximately 10–12 kcalÆmol)1,...
- 9
- 494
- 0
Cell Biology and Cancer under a contract from the National Institutes of Health doc
... life; as a class, they assemble data about the population as a whole Students examine the data the class assembles and draw a set of important generalizations about cancer from them These generalizations ... its associa tion with the skin cancer on the hand of a lab technician by 1902 Within a decade, many more physicians and scientists, unaware of the dangers of radiation, developed a variety of cancers ... NCI and created the National Cancer Program Over the years, the NCI’s mandate has come to include dis semination of current cancer information and assess ment of the incorporation of state -of -the- art...
- 164
- 578
- 0
101 Quick and Easy Ideas Taken from the Master Photographers of the Twentieth Century
... right of the burning area and a bare tree to the left The Rockies sit in the background, extending about a sixth of the way from the bottom of the frame Parts of the sky are the same shade of black ... Ansel Adams I 13 8×10 view camera All of those are heavy, and the view cameras are extremely hard to handhold and focus because the image is displayed on the back glass upside-down (and you need a ... classes in a tough economic climate Many of these images are portraits of people in daily activities, such as a portrait of a woman at a crowded beach and one of a family at the dinner table He also...
- 254
- 3,126
- 0
Adolescent Sexual and Reproductive Health in Ghana: Results from the 2004 National Survey of Adolescents doc
... spoken local languages in Ghana The approach adopted for the translation was to first translate the questionnaires into the Ghanaian languages and then back into English The retranslated English ... the past year and the past three months As was shown in Table 4.2, 30% of females and 16% of males aged 15–19 years and only 1–2% of females and males aged 12–14 years had ever had sexual intercourse ... that 78% of females and 60% of males who had ever had sex reported only one lifetime sexual partner Another 18% of females and 21% of males had two lifetime sexual partners and 4% of females and...
- 148
- 664
- 0
Báo cáo khoa học: Defining the QP-site of Escherichia coli fumarate reductase by site-directed mutagenesis, fluorescence quench titrations and EPR spectroscopy doc
... the steady-state kinetic behavior of wild-type and a subset of the mutants of FrdABCD in DW35 membranes The wild-type enzyme has a Km for LPCH2 of approximately 225 lm and a kcat of approximately ... was funded by the Canadian Institutes of Health Research and the Canada Foundation for Innovation A. -M.C.S and A. M.S were supported by Alberta Heritage Foundation for Medical Research Summer Studentships ... (at a QD site), and that electron-transfer across the membrane to ⁄ from the catalytic dimer is mediated by the two hemes in a manner similar to that observed in E coli nitrate reductase A (NarGHI)...
- 14
- 359
- 0
Báo cáo khoa học: Isolation and identification of antimicrobial components from the epidermal mucus of Atlantic cod (Gadus morhua) docx
... collected from the skin exhibited high antimicrobial activity against Gram-positive and Gram-negative bacteria, as well as against the yeast C albicans As seen in Fig and Table 1, the antiCandida activity ... mm) and for E coli at 2000 and 1000 mm Growth of C albicans was observed at all concentrations of NaCl After incubation of the extracts with pepsin, the antibacterial activity of the extract was ... activity of the cod mucus extract The mucus extract, comprising approximately 42% protein, was assayed for antimicrobial activity against Bacillus megaterium, Escherichia coli and Candida albicans The...
- 10
- 391
- 0
Báo cáo khoa học: A steady-state competition model describes the modulating effects of thrombomodulin on thrombin inhibition by plasminogen activator inhibitor-1 in the absence and presence of vitronectin ppt
... inhibitor and release of active enzyme A decreased overall inhibition rate can thus be the result of a shift of the rate constants of the branched part of mechanism, i.e increased cleavage at the expense ... the thrombin-VR1tPA–PAI-1 interaction appears to Fig TM does not alter the distribution of the cleavage and substrate pathway Analysis by SDS/PAGE of the products of the reaction of 600 nM thrombin ... inactivation of the PAI-1 pool in the vascular wall by thrombin, making it no longer available for interaction with u-PA and VN, which can explain part of the effect of thrombin on the proliferation and...
- 10
- 483
- 0
Báo cáo Y học: Implications of the simultaneous occurrence of hepatic glycolysis from glucose and gluconeogenesis from glycerol pdf
... work was supported by grants from the Australian National Health and Medical Research Council, the Flinders Medical Centre Foundation and the Drug and Alcohol Services Council of South Australia ... whereas ATP concentrations fell The extent of these changes and the rate of glycerol uptake and glucose synthesis were dependent on the initial concentration of added substrate and were maximal by ... for the separation of radiolabelled glucose and its metabolic products, were obtained from Bio-Rad (Hercules, CA, USA) Preparation and incubation of hepatocytes Hepatocytes were prepared from male...
- 6
- 328
- 0
Health Education: Results From the School Health Policies and Programs Study 2006 pptx
... school levels; staffing and staff development; collaboration between health education staff and other agency and organization staff; and the educational background and credentials of the person who ... 23 state education agencies, and through them their state health agencies, to build state education agency and state health agency partnerships and their capacity to implement and coordinate school ... expectations for health education The Joint Committee on National Health Education Standards released the first set of standards in 1995.15 The National Health Education Standards Review and Revision...
- 27
- 316
- 0
Báo cáo khoa học: The functional genomics of guanylyl cyclase⁄natriuretic peptide receptor-A: Perspectives and paradigms potx
... synergistic actions of ANP and BNP and their cognate receptor GC -A ⁄ NPRA make them novel therapeutic targets in renal, cardiac and vascular diseases The critical physiological and pathophysiological ... cardiovascular sequelae such as hypertension, heart attack, and stroke Nevertheless, the paradigms of the molecular basis of the functional regulation of Npr1 and the mechanisms of ANP–NPRA action ... dysplasia [144] Biological actions of GC -A ⁄ NPRA in renal and vascular cells ANP–NPRA signaling in the kidneys promotes the excretion of salt and water, and enhances glomerular filtration rate and...
- 16
- 635
- 0
Defining Public Administration: Selections from the International Encyclopedia of Public Policy and Administration doc
... Layering and striating all of this early American activity in drafting confederations and constitzrtions kvas the massive brilliance of the early American political elite, " u particularly that of Hamilton ... appmaches, and concepts h early exmple of this appmach to the theory of public admkistratian is that af Robert B* Denhardt and Jan Perkirrs (1976), who argued that mainstream organizational analysis ... manage, and have a loud voice in the adjudication of the laws within the bomds of his (that is, the sherif-fs)shire That all, of the states were influenced by King Edgar % aadministrative creativity...
- 465
- 388
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25