amp foot amp heel model of a biped robot for more natural walking foot mechanism amp gait pattern
báo cáo hóa học:" Establishment of an animal model of a pasteurized bone graft, with a preliminary analysis of muscle coverage or FGF-2 administration to the graft" potx
... bridging or lamellar bone formation (2) An assessment of these results was made and agreed upon by AS, TY and NT Tartrate-resistant acid phosphatase (TRAP) staining After radiographical examination, ... immediate reimplantation of resected bone J Craniomaxillofac Surg 1991, 19:31-39 Ehara S, Nishida J, Shiraishi H, Tamakawa Y: Pasteurized intercalary autogenous bone graft: radiographic and scintigraphic ... and graft bone of the harvested samples radiographically Bone formation on the host bone was assessed When the new bone formation was larger than the nearby cortex, the bone formation was classified...
- 10
- 478
- 0
Báo cáo hóa học: " Linear Rashba Model of a Hydrogenic Donor Impurity in GaAs/GaAlAs Quantum Wells" potx
... Rashba spin-orbit splitting energy of a hydrogenic donor impurity in a GaAs=Ga0:65 Al0:35 As QW We take the effective mass parameters of [13] and the Rashba parameter a0 ¼ 10À12 eV m [14] The spin-orbit ... À j j2zj À 1jÞ for jzj W; W aR ðzÞ ¼ ð3Þ for jzj [ W; where a0 is the maximum value of the Rashba spin-orbit effect at the side of the QW The Rashba parameter is a function of z and is dependent ... -W/2 W/2 W Fig The Rashba parameter as a function of z The horizontal and vertical dashed lines indicate the value of a0 and the borderline of the QW, respectively Fig The change in spin-orbit...
- 3
- 248
- 0
Báo cáo y học: "Development of a practical guide for the early recognition for malignant melanoma of the foot and nail unit" potx
... from a warty acral amelanotic malignant melanoma Eur J Dermatol 2001, 11:591-592 37 Fountain JA: Recognition of subungual hematoma as an imitator of subungual melanoma J Am Acad Dermatol 1990, ... T: Acral lentigious melanoma misdiagnosed as verruca plantaris: a case report Dermatol Online J 2006, 12 36 Virgili A, Corazza M: Guess what! Metastatic malignant melanoma of the leg from a warty ... search strategy A literature search was undertaken using the National Library of Medicine (NLM) PubMed database to identify literature on foot and nail melanoma A range of search terms was devised...
- 4
- 403
- 0
Realizing an AD+ model as a derived model of a premouse
... there is a set of ordinals S, an ordinal and a formula such that x ✓ A $ L↵ [S, x] = [S, x] If is an ordinal and A ✓ ! , then A is determined if either of the two players has a winning strategy ... HOD analysis of AD+ models below LST (the largest ✓ is a Suslin cardinal) The translation is likely to generalize as long as HOD of an AD+ model is well understood A plausible conjecture is that ... cardinals are overlapped by extenders Woodin’s derived model theorem plays a important role in analysis of premice with Woodin cardinals Models of determinacy appears when we reach Woodin cardinals...
- 164
- 281
- 0
Sensor-based navigation of a mobile robot in an indoor environment
... to the actual characteristics of the robot This means that the rough and manual tuning of the parameters of the fuzzy controller is replaced by a fine local automatic tuning and Table Angular speed ... the reactive behaviors of the robot, the STFIS has the following two main advantages: Fig Concave obstacle skirting away from the target and the distance of displacement is greater than a threshold ... concave obstacles That is why coordination of S1 and another elementary behavior of wall-following type including the creation of transition sub-goals develop a second strategy S2 As a matter of...
- 18
- 431
- 0
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
... gagcaataac 320 321 tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA 360 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ATGCCTACAG 440 441 CATCCAGGGT TTG GACGGTGCCG ... gaaaaaatgc cgccgcgata gcgattgccc gggcgcgtca 200 201 tttgccgcgg caacggctat tgcggctaac tcgagcccgg 240 241 gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac ... primers for MCoTI-II gene cttaaggtatactcgccgtcgcgtaccgccgcacacgggcttt gaattccatatgagcggcagcgatggcggcgtgtgcccgaaa M S G S D G G V C P K taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg...
- 9
- 497
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, ... 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were cloned into the EcoRV site of ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...
- 11
- 873
- 0
Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx
... re-ranking tasks: a parse selection task and a language model adaptation task Then we apply the best of these estimators to two additional tasks involving conditional sequence models: a CMM for ... trigram model trained on background domain corpus, and MAP (maximum a posteriori) is a traditional model adaptation method, where the parameters of the background model are adjusted so as to maximize ... Boosted Lasso The Boosted Lasso (BLasso) algorithm was originally proposed in Zhao and Yu (2004), and was adapted for language modeling by Gao et al (2006) BLasso can be viewed as a version of Boosting...
- 8
- 504
- 0
Báo cáo "Development of a software package for 3D structured mesh generation " pdf
... inverse mapping between the 3D real computational domain and a rectangular domain in the parametric space [1, 2, 5, 6] For short, the formulae for Y and Z coordinates are the same and they are not ... simulations 4.1 The graphic user interface of the package The package is designed with a main interface that allows users to input topographical elevation data of the top (upper) surface of any ... close to the real area has to be greater than that afar Fig 21 The 3D computational domain surrounding a real 3D topography 104 D.N Hai, N.T Thang / VNU Journal of Science, Mathematics - Physics...
- 14
- 402
- 0
Báo cáo khoa học: "Automatic Induction of a CCG Grammar for Turkish" pptx
... Head-driven Statistical Models for Natural Language Parsing Ph.D thesis, University of Pennsylvania Julia Hockenmaier 2003 Data Models for statistical parsing with Combinatory Categorial Grammar Ph.D ... Combinatory Categorial Grammar Ph.D thesis, University of Edinburgh Yehoshua Bar-Hillel, C Gaifman, and E Shamir 1964 On categorial and phrase structure grammars In Language and Information ed Bar-Hillel, ... there are many smallscale treebanks being developed for understudied languages, it is important to explore ways to boost the performances of statistical parsers from small amounts of human labeled...
- 6
- 373
- 0
Báo cáo khoa học: "PEAS, the first instantiation of a comparative framework for evaluating parsers of French" potx
... the address of its parameters Of course, all of them are not to be filled in All the information thus annotated is then translated into an XML format Annotation of the example of §2 is translated ... syntactic coverage of English grammars In DARPA, editor Proceedings of the Fourth Darpa Speech and Natural Language Workshop, pages 306-311, Pacific Grove, California, February, Morgan Kaufmann ... divergent parses.' Last of all, the XML format into which we translate the parses is an open exchange format It is an important asset for portability and reuse of parsing technolgy E.g for question answering...
- 4
- 323
- 0
Báo cáo khoa học: Inhibition of a-synuclein fibrillization by dopamine analogs via reaction with the amino groups of a-synuclein Implication for dopaminergic neurodegeneration pot
... analogs with a- Syn and some amino acids (A) UV-vis spectra of a- Syn with DA, CA, HQ and Q after reaction for 24 h The a- Syn alone sample was as a control The concentration of a- Syn was 200 lM and ... lM) was incubated with 200 lM of HQ (middle) or DA (right) for days The a- Syn alone sample was as a control (left) All graphs are topographical height images of lm2 in area and the scale bar represents ... assay The concentration of a- Syn was 200 lM and the fibrillization of a- Syn alone was as a comparison Data were represented as means ± SEM (F) Atomic force microscopic images of a- Syn fibrils a- Syn...
- 12
- 414
- 0
Báo cáo khoa học: "The Design of a Computer Language for Linguistic Information" ppt
... be = V Con- structs Clearly, the bare PATR-II formalism, as it was presented in Section 2.1, is sorely inadequate for any major attempt at building natural- language grammars because of its ... the grammar formalism itself, 6The example is merely meant to be indicative of the syntax for and operation of lexical rules We not present this as a valid definition of Passive for any grammar ... syntactic, and semantic information, and one operation unification on this representation By way of example, we present a trivial grammar for a fragment of English with a lexicon associating words...
- 5
- 383
- 0
Evaluation of a diagnostic algorithm for smear-negative pulmonary tuberculosis in HIV-infected adults doc
... 55probable TB cases (3 probable TB cases (3 ‡ had military patterns on had miliary patterns on CXR, and had high ADA CXR, and had high ADA levels in pleural effusion, all levels in pleural effusion, ... Table I Baseline data for the 58 smear-negative patients (continued) Characteristic Adenopathy Infiltrate and adenopathy Pleural effusion/thickening and infiltrates Pleural effusion and adenopathy ... classified as having ‘probable’ TB, defined as clinical improvement after weeks of TB treatment and a miliary pattern on chest radiograph or pleural effusion with an ADA level > 30 U/l Four of...
- 7
- 366
- 0
Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx
... that will be required upon hand-off for assay validation SJ, AW, SWA and KA performed the in vitro assays on monkeys treated with Ab-01 and control Ig and analyzed the data, and KA and SA performed ... were among the "inventoried" assays available from ABI, and are described in Table cDNA synthesis, preparation of samples for TLDA assay and measurements of RNA concentration were performed as ... 10.1186/1479-5876-8-51 Cite this article as: Arai et al., Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R...
- 13
- 528
- 0
báo cáo hóa học: " Rehabilitation robotics: pilot trial of a spatial extension for MIT-Manus" pdf
... application of robotics as a therapy aid, and in particular a tool for therapists We foresee robots and computers as supporting and enhancing the productivity of clinicians in their efforts to facilitate ... Additional Vertical Anti-Gravity Training at the Burke Rehabilitation Hospital Graduates from Planar Robot Protocol Receiving Additional Vertical Anti-Gravity Training at the Burke Rehabilitation ... MIT-MANUS to allow spatial movements Note that in the standalone fashion it can be operated at any angle to the horizontal and vertical planes with adjustable handle positions Page 12 of 15 (page...
- 15
- 298
- 0
Báo cáo hóa học: " Strong convergence of a hybrid method for monotone variational inequalities and fixed point problems" ppt
... literature for solving a more general problem that consists of finding a common point that lies in the solution set of a variational inequality and the set of fixed points of a nonexpansive mapping ... inequalities Carpathian J Math 24, 139–148 (2008) He, BS, Yang, ZH, Yuan, XM: An approximate proximal-extragradient type method for monotone variational inequalities J Math Anal Appl 300, 362–374 ... nonlinear variational problems Springer, New York (1984) Iusem, AN: An iterative algorithm for the variational inequality problem Comput Appl Math 13, 103–114 (1994) Yao, JC: Variational inequalities...
- 10
- 425
- 0
Báo cáo hóa học: "Setup, efforts and practical experiences of a monitoring program for genetically modified plants - an Austrian case study for oilseed rape and maize" pptx
... feral B napus, B nigra, feral B oleracea, wild and feral B rapa, Conringia austriaca, C orientalis, Crambe tatarica, Diplotaxis muralis, D tenuifolia, Eruca sativa, Erucastrum gallicum, E nasturtiifolium, ... http://www.eea europa.eu/data-and-maps/data/eea-reference-grids which is used as the standard reference grid for all spatial statistic data in Austria Hence, we have a direct spatial link between our BINATS ... types, climatic conditions and management regimes of a country; (2) baseline data necessary for detecting changes in the abundance and diversity of plants and animals as well as in habitat structures...
- 12
- 497
- 0
- 87 vhdl model of a 74x74 like d flip flop with preset and clear
- 88 vhdl model of a 16 bit register with many features
- mathematical model of a pendulum
- mathematical model of a circuit network
- mathematical model of a boost converter
- small signal model of a forward biased diode
- download and open a 3d model of a part
- parametric model of a golf club
- adams android model of a golfer
- a new aerodynamic model of a golf ball in flight
- the entity relationship model of a database
- model of a bouncing ball
- maneuvering model of a high speed vehicle amp 8211 passenger trimaran
- the very model of a modern major conspiracy theory
- model predictive control of a flexible robot
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008