0

the very model of a modern major conspiracy theory

Báo cáo khoa học

... discusses the use of HHMMs for the text chunking task and the grammar parser The evaluation results of the HMM, the plain HHMM and the merged and partially flattened HHMM are presented in Section Finally, ... chunking task The results suggest that the partial flattening process is capable of improving model accuracy when the input data contains complex hierarchical structures The evaluation involves analysing ... different model on the Lancaster Treebank data set The models used in this evaluation were trained with observation data from the Lancaster Treebank training set The training set and testing set are...
  • 8
  • 528
  • 0
The first three minutes   a modern view of the origin of the universe   s  weinberg

The first three minutes a modern view of the origin of the universe s weinberg

Vật lý

... this apparent paradox, including perhaps the steady-state theory It may be that the removal of the age paradox by the tenfold expansion of the extragalactic distance scale in the 1950S was the ... of the Heavens suggested that the nebulae 'or rather a species of them' are really circular discs about the same size and shape as our own galaxy They appear elliptical because most of them are ... points A and B are the same, draw a circle through A around galaxy 1, and another circle through B around galaxy Isotropy around galaxy requires that conditions are the same at A and at the point...
  • 168
  • 414
  • 0
báo cáo hóa học:

báo cáo hóa học:" Establishment of an animal model of a pasteurized bone graft, with a preliminary analysis of muscle coverage or FGF-2 administration to the graft" potx

Hóa học - Dầu khí

... quantitatively measured in the of the host The size 2of the bone formationlateral view bone was also The size of the bone formation of the host bone was also quantitatively measured in the lateral ... in the lateral view using Alpha Ease FC software (Alpha Innotech, San Leandro, CA, USA) The area was calculated in relation with that in the (MC-; FGF2-) group at weeks in ratio Bone incorporation, ... phosphatase (TRAP) staining After radiographical examination, the femurs with the graft were decalcified with EDTA (ethylenediaminetetraacetic acid), and cut sagittally, then stained with hematoxylin...
  • 10
  • 478
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " The Cramer-Rao Bound and DMT Signal Optimisation for the Identification of a Wiener-Type Model" pptx

Báo cáo khoa học

... diagram of the application of a nonlinear canceler of the hybrid echo for an ADSL transceiver system tones in the input signal and of a finite number of samples for the estimation of the model parameters ... [n] The Cramer-Rao bound is the theoretical lower bound for ˆ the variance of all unbiased estimators θ for the model parameters θ and is determined by the diagonal elements of the inverse of the ... variance σu = 0.64 The figure reveals that there is a high covariance between the linear parameters and the third-order parameters That corresponds to the known fact that even in the case of a...
  • 14
  • 294
  • 0
EFFECTIVE THERMAL INSULATION – THE OPERATIVE FACTOR OF A PASSIVE BUILDING MODEL ppt

EFFECTIVE THERMAL INSULATION – THE OPERATIVE FACTOR OF A PASSIVE BUILDING MODEL ppt

Kĩ thuật Viễn thông

... Amjad Almusaed Archcrea Institute, Aarhus Denmark Part Passive Building Model and Thermal Insulation Improvement of Thermal Insulation by Environmental Means Amjad Almusaed1 and Asaad Almssad2 ... 20% of the area needs high thermal care 80% of the area needs low and middle thermal care Bath room 80% of the area needs high thermal care 20% of the area needs middle thermal care Table The ... room Thermal care level 80% of the area needs high thermal care 20% of the area needs middle thermal care Bed room 85% of the area needs high thermal care 15% of the area needs middle thermal care...
  • 112
  • 449
  • 0
Báo cáo y học:

Báo cáo y học: " Draft genome sequence of the Daphnia pathogen Octosporea bayeri: insights into the gene content of a large microsporidian genome and a model for host-parasite interactions" pps

Báo cáo khoa học

... Evolution of the ATP transporter family based on available amino acid sequences from a range of microsporidian parasites 1, Putative ancestral duplication of ATP transporters within the microsporidia ... nothing about the overall organization of the genome because the fragments sampled were small and only a tiny fraction of the genome was characterized in any one case [35,36,38] The data presented ... uncultivatable organisms from which only a handful of contaminant-free DNA can be extracted Finally, an important goal of the present study was to gather a large amount of genome sequence information...
  • 12
  • 400
  • 0
Báo cáo y học:

Báo cáo y học: "Use of a highly sensitive strand-specific quantitative PCR to identify abortive replication in the mouse model of respiratory syncytial virus disease" pptx

Báo cáo khoa học

... ATAGGATCCTGCTAAGACTCCCCACCGTAA2 Positive sense RNA-specific cDNA synthesis CGGTCATGGTGGCGAATAATCCTGCAAAAATCCCTTCAACT3 Negative sense RNA-specific cDNA synthesis CGGTCATGGTGGCGAATAAACTTTATAGATGTTTTTGTTCA3 Positive ... CGGTCATGGTGGCGAATAA Probe TCCTGCAAAAATCCCTTCAACT QPCR tag primer CCCCACTTTATAGATGTTTTTGTTCA Negative sense-specific QPCR primer FAM-TTGGTATAGCACAATCTTCTACCAGAGGTGGC-TAMRA Sequence contains an EcoRI ... than the cotton rat [19], constitutes a more practical model due to the availability of a larger number of immunological and molecular reagents as well as the availability of transgenic animals...
  • 11
  • 348
  • 0
Báo cáo y học:

Báo cáo y học: "Protective effect of the DNA vaccine encoding the major house dust mite allergens on allergic inflammation in the murine model of house dust mite allergy" ppsx

Báo cáo khoa học

... 5'TGCTCTAGATTAGAGAATGACAACATATGGATATTC -3'), Der p (5'- CCGGAATTCGCCGCCACCATGGATCAAGTCGATGTCAAAGATTGTGCC -3' and 5'TGCTCTAGATTAATCGCGGATTTTAGCATGAGTAGCAAT -3'), Der p (5'- CCGGAATTCGCCGCCACCATGATTGTTGGTGGTGAAAAAGCATTAGCTG ... CCGGAATTCGCCGCCACCATGATTGTTGGTGGTGAAAAAGCATTAGCTG -3' and 5'TGCTCTAGATTACTGTGAACGTTTTGATTCAATCCAATCGATA -3'), Der f (5'- CCGGAATTCGCCGCCACCATGGAAACAAGCGCTTGCCGTATCAATTCG -3' and 5'TGCTCTAGATTAGAGGTTGTTTCCGGCTTGGAAATATCCG -3'), Der ... http://www.clinicalmolecularallergy.com/content/4/1/4 CCGGAATTCGCCGCCACCATGGATCAAAGTCGATGTTAAAGATTGTGCC -3' and 5'- TGCTCTAGATTAATCACGGATTTTACCATGGGTAGCAAT -3'), and Der f (5'CCGGAATTCGCCGCCACCATGATTGTTGGTGGTGTGAAAGCACAAGCC...
  • 9
  • 297
  • 0
Báo cáo y học:

Báo cáo y học: "A proposed adaptation of the European Foundation for Quality Management Excellence Model to physical activity programmes for the elderly - development of a quality self-assessment tool using a modified Delphi process" ppt

Báo cáo khoa học

... Pedro Soares pedromortaguasoares@gmail.com Rute Santos rutemarinasantos@hotmail.com António Oliveira-Tavares oliveiratavares@netvisao.pt Jorge Mota jmota@fade.up.pt Joana Carvalho jcarvalho@fade.up.pt ... that these results are related to the fact that many experts are programme leaders and thus, are more aware of practices that pertain to Leadership Also, experts may have been aware of the fact ... editing the manuscript AOT and RS managed the data collection and analysis JC participated in the coordination of the study and supervised the drafting and editing of manuscript All authors reviewed...
  • 30
  • 369
  • 0
Báo cáo y học:

Báo cáo y học: "The Dictyostelium genome: the private life of a social model revealed" potx

Báo cáo khoa học

... repeats are apparently translated to form poly-asparagine, which makes up a substantial fraction of some proteins The description of the whole genome allows the large scale of these repeats in ... amoeba whose genome has recently been sequenced [5] Entamoeba is an intestinal parasite of mammals, causing diseases such as amoebic dysentery - an antisocial amoeba to Dictyostelium’s social amoeba, ... from the animal lineage before fungi and yeasts, but after plants From the point of view of its use as a model organism, the evolutionary distance between Dictyostelium and human is actually...
  • 4
  • 314
  • 0
Classification of the asymptotic behavior of a stochastic SIR model

Classification of the asymptotic behavior of a stochastic SIR model

Toán học

... the per capita birth rate of the population, µ is the per capita disease-free death rate and ρ is the excess per capita death rate of infective class, β is the effective per capita contact rate, ... individuals who are capable of contracting the disease and becoming infective, • (I), the infective class, i.e., the class of those individuals who are capable of transmitting the disease to others, ... implies the ergodicity of the diffusion as well as the convergence in total variation of the transition probability to the invariant measure (see [6, 15]) As a result we have the following theorem...
  • 21
  • 410
  • 0
The Marketing Strategy of a multinational join stock company.doc

The Marketing Strategy of a multinational join stock company.doc

Quản trị kinh doanh

... (Japanese), Trane (American) and Sanyo (Japanese) These are famous brands in the world market and Vietnamese consumers highly appreciate them A multinational join stock company has never had any ... providing and preceding the contracts Organizing the sales of products is another main task of the department • Financial and Accounting department: this department deals with all financial and accounting ... 5D The Marketing Strategy of a multinational join stock company if they take care of their customers, market share and profits will follow Creating customer values and satisfaction is at the very...
  • 25
  • 623
  • 8
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

Kỹ thuật lập trình

... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property of the DataColumn SetNull Indicates ... to the parent table Updating the Primary Key of a Parent Table and Pushing the Change to the Database In this section you'll learn what happens if you attempt to update the primary key in a parent ... that the DataColumn values in the child DataTable are to be set to DBNull By default, UpdateRule is set to Cascade; therefore, when you change the DataColumn in the parent DataTable on which the...
  • 6
  • 428
  • 0
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc

Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc

Báo cáo khoa học

... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... with NADH and NADPH, but the catalytic rate constant using NADPH was only half that of the wild type The catalytic efciency, expressed as kcat/Km, of the R197E mutant using NADPH was then about...
  • 8
  • 494
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx

Báo cáo khoa học

... Proceedings of Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation ... Empirical Methods in Natural Language Processing Weiwei Guo and Mona Diab 2012 Modeling sentences in the latent space In Proceedings of the 50th Annual Meeting of the Association for Computational ... disambiguation In the 12th Conference of the European Chapter of the ACL Satanjeev Banerjee and Ted Pedersen 2003 Extended gloss overlaps as a measure of semantic relatedness In Proceedings of the...
  • 5
  • 585
  • 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Báo cáo khoa học

... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG ... glutamine to the active site location of the iron enzyme (Fe [A1 41Q]) has a very similar effect to removal of the existing glutamine and SOD activities are reasonably similar between the two mutants...
  • 12
  • 740
  • 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Báo cáo khoa học

... environmental factors that are taken into account in the calculations (background charges, desolvation penalty and the interaction with other titratable residues), the first factor was found to be the major ... functionality of such a triad is affected by the surrounding residues The results so far indicate that larger parts of the polar core of the catalytic TIM barrel of family 18 chitinases play a role ... that in the presence of the substrate, rotation of Asp142 towards Glu144 lowers the pKa of the latter by 0.8 pH units The calculated effects of the D140N and D215N mutations varied drastically...
  • 10
  • 651
  • 0
Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt

Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt

Báo cáo khoa học

... SUMA software: subsite mapping of amylases This software calculates the apparent binding energies on the basis of the measured bond cleavage frequencies The calculations are based on the equation: ... Subsite map of barley a- amylase isoenzyme The binding a nities were calculated according to the data of Table Fig Subsite maps for porcine pancreatic a- amylase (PPA) The solid bars are related to ... can vary according to the calculations The primary calculated subsite energy values can be refined to the best agreement of the measured and recalculated BCF data by the iteration Fig shows the...
  • 6
  • 387
  • 0
Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf

Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf

Báo cáo khoa học

... 1ERT) as a search model, then refined smoothly in alternating steps of automatic adjustment with CNS and manual adjustment with the program O [34] The final model has a final R-factor of 0.222 with a ... Murakawa, M., Takahashi, S., Tsubuki, S., Kawashima, S., Sakamaki, K & Yonehara, S (1998) Purification, molecular cloning, and characterization of TRP32, a novel thioredoxin-related mammalian ... hTRXL-N may account for the formation of a monomer, instead of a dimer in the case of TRX Furthermore, the loss of intermolecular disulfide-bonds and the disbandment of the hydrophobic patch may also...
  • 9
  • 533
  • 0

Xem thêm