a reliable source of stem and progenitor cells for human transplantation
Báo cáo y học: "Human palatine tonsil: a new potential tissue source of multipotent mesenchymal progenitor cells" pdf
... gene GAPDH Sense: GGACTCATGACCACAGTCCATGCC Antisense: TCAGGGATGACCTTGCCCACA Bone-specific genes ALP Sense: TGGAGCTTCAGAAGCTCAACACCA Antisense: ATCTCGTTGTCTGAGTACCAGTCC OC Sense: ATGAGAGCCCTCACACTCCTC ... ATGAGAGCCCTCACACTCCTC Antisense: GCCGTAGAAGCGCCGATAGGC Adipose-specific genes LPL Sense: GAGATTTCTCTGTATGGCACC Antisense: CTGCAAATGAGACACTTTCTC PPARγ Sense: TGAATGTGAAGCCCATTGAA Antisense: CTGCAGTAGCTGCACGTGTT Cartilage-specific ... Cartilage-specific genes AGN Sense: TGCGGGTCAACAGTGCCTATC Antisense: CACGATGCCTTTCACCACGAC COL 2A1 Sense: GGAAACTTTGCTGCCCAGATG Antisense: TCACCAGGTTCACCAGGATTGC AGN, aggrecan; ALP, alkaline phosphatase;...
- 12
- 359
- 0
IMPACT OF ALCAM (CD166) ON HOMING OF HEMATOPOIETIC STEM AND PROGENITOR CELLS Mariya Aleksandrova
... price of this thesis, as he suffered through it with me and paid the greater portion of it iii ABSTRACT Mariya Aleksandrova Aleksandrova IMPACT OF ALCAM (CD166) ON HOMING OF HEMATOPOIETIC STEM AND ... Absolute percentage (bars) of donor Sca-1+ALCAM+ cells pre -transplantation (Day 0), and 16 hours post -transplantation (Day 1) isolated from vascular and endosteal marrow were determined by FACS ... selecting for both hematopoietic stem and progenitor cells, such as Sca-1, allowed for a valid evaluation of homing potential of HSPC, represented by Sca-1+ALCAM+ cells Flow Cytometric Analysis and...
- 50
- 241
- 0
A discourse analysis of english and vietnamese advertisements for beauty care products
... their base form but also comparatives and superlatives are used in the Body Copy of EAPs and VAPs Remarkably, English and Vietnamese advertisers have the tendency of using the base form of evaluative ... blend of other natural berry ingredients for normal hair & daily use Hydrates the hair and soothes the scalp Leaves hair soft, healthy and manageable [A- 28] Additionally, in order for readers ... Questions What are the features of EAPs and VAPs in terms of their layout, lexical features, syntactic features and cohesive devices? What are the similarities and differences between EAPs and VAPs in...
- 13
- 1,142
- 6
Báo cáo y học: " The development of a knowledge test of depression and its treatment for patients suffering from non-psychotic depression: a psychometric assessment" ppt
... patients were on antidepressant medication, and all had seen their clinicians on at least two occasions for standard treatment and standard psycho-education as a part of standard clinical care prior ... treatments (antidepressants, antipsychotics, electroconvulsive therapy, and admission to a psychiatric ward) were more often rated as harmful than helpful, and some nonstandard treatments (increased ... clear language at the appropriate level (Grade 9) and was as much as possible without medical or psychiatric jargon, 3) each requires patient knowledge to be demonstrated in a specific area of...
- 15
- 416
- 0
Báo cáo y học: "A unified framework of immunological and epidemiological dynamics for the spread of viral infections in a simple network-based population" ppt
... parameter values and Variations accumulated viral load their effect on the populaVariations in parameter values and their effect on the population-wide accumulated viral load Additional parameter ... responsiveness and the overall behaviour of an outbreak (A) , as well as the overall severity an outbreak (B), as measured by the mean and accumulated viral load in the population, respectively Mean and accumulated ... (black and red lines) occurs Figure after (A) and accumulated (B) viral Mean100 Monte Carlo realizations loads in the population Mean (A) and accumulated (B) viral loads in the population after...
- 13
- 334
- 0
PROMOTING A UNIVERSITY CULTURE OF INNOVATION AND PRODUCT DEVELOPMENT FOR IGR
... generating sales, and creating brand loyalty CULTURE • relates to the habits, beliefs, and traditions of a certain people ; • it is the characteristics and knowledge of a particular group of people ... CONT’D PRODUCT • A good, idea, method, information, object or service created as a result of a process and serves a need or satisfies a want • a combination of tangible and intangible attributes (benefits, ... public relations? • The Public Relations Institute of Australia (PRIA) defines Public Relations (PR) as: “The deliberate, planned and sustained effort to establish and maintain mutual understanding...
- 35
- 326
- 0
Báo cáo hóa học: "The toxicity of cadmium and resulting hazards for human health" ppt
... average smoker has an additional intake of 30 μg per day [4] Several factors can increase this amount, such as low intakes of vitamin D, calcium, and trace elements like zinc and copper 0.01% and ... intake of cadmium-contaminated food causes acute gastrointestinal effects, such as vomiting and diarrhoea [18] Page of (page number not for citation purposes) Journal of Occupational Medicine and ... urinary concentration reflects past exposure, body burden and renal accumulation [3] Excretion of Cadmium takes place via faeces and urine Figure gives a scheme on the handling of Cadmium in human...
- 6
- 736
- 0
báo cáo hóa học:" Human fallopian tube: a new source of multipotent adult mesenchymal stem cells discarded in surgical procedures" potx
... Célia Koiffmann and Cláudia I E de Castro for karyotype analysis and pictures; Marta Cánovas for technical support; Page of 10 (page number not for citation purposes) Journal of Translational ... Mariz Vainzof for WB analysis and suggestions; Dr Irina Kerkis for antibodies supplying; Marcos Valadares and Maria Denise Fernandes Carvalho for the support with the cultures Mrs Constancia ... characterization of potential sources of adult stem cells [7,10,1215], the aim of this study was to isolate, expand, characterize and assess the differentiation potential of MSCs from hFTs Methods Human...
- 10
- 456
- 0
Báo cáo hóa học: " Nutraceutical augmentation of circulating endothelial progenitor cells and hematopoietic stem cells in human subjects" potx
... Published: April 2010 21 References Kawamoto A, Katayama M, Handa N, et al: Intramuscular transplantation of G-CSF-mobilized CD34(+) cells in patients with critical limb ischemia: a phase I/IIa, multicenter, ... average values of ATP in growth factor stimulated and not stimulated cells was calculated and compared for different periods before and after intervention Stem- Kine mobilizes CD34 and CD133 Cells ... RH, JAK, JK, KWA, CAS, BM, ANP, MPM, LS, FR, and TEI provided detailed ideas and discussions, and/ or writing of the manuscript NAM and JAJ performed the experiments All authors read and approved...
- 10
- 665
- 0
Báo cáo sinh học: "Safety and feasibility of third-party multipotent adult progenitor cells for immunomodulation therapy after liver transplantation–a phase I study (MISOT-I)" doc
... Raber A, Maitra A, Deans R, Rao MS, Ting AE: Global Characterization and Genomic Stability of Human MultiStem, A Multipotent Adult Progenitor Cell J Stem Cells 2009, 4:17-28 Mays RW, van’t Hof ... MJ, Korevaar SS, Peeters AM, Eijken M, Maat LP, Balk AH, Weimar W, Baan CC: Susceptibility of human mesenchymal stem cells to tacrolimus, mycophenolic acid, and rapamycin Transplantation 2008, ... Infusion of mesenchymal stem cells and rapamycin synergize to attenuate alloimmune responses and promote cardiac allograft tolerance Am J Transplant 2009, 9:1760-1772 Casiraghi F, Azzollini N, Cassis...
- 10
- 451
- 0
báo cáo hóa học:" Safety and feasibility of third-party multipotent adult progenitor cells for immunomodulation therapy after liver transplantation–a phase I study (MISOT-I)" pptx
... Raber A, Maitra A, Deans R, Rao MS, Ting AE: Global Characterization and Genomic Stability of Human MultiStem, A Multipotent Adult Progenitor Cell J Stem Cells 2009, 4:17-28 Mays RW, van’t Hof ... MJ, Korevaar SS, Peeters AM, Eijken M, Maat LP, Balk AH, Weimar W, Baan CC: Susceptibility of human mesenchymal stem cells to tacrolimus, mycophenolic acid, and rapamycin Transplantation 2008, ... Infusion of mesenchymal stem cells and rapamycin synergize to attenuate alloimmune responses and promote cardiac allograft tolerance Am J Transplant 2009, 9:1760-1772 Casiraghi F, Azzollini N, Cassis...
- 10
- 438
- 0
Báo cáo y học: "Effect of a small molecule inhibitor of nuclear factor-κB nuclear translocation in a murine model of arthritis and cultured human synovial cells" pps
... 3'-TAAAACAGGGTGTCTGGGGA), IL-1β (5'-TGCACGATGCACCTGTACGA, 3'-AGGCCCAAGGCCACAGGTAT), IL-6 (5'-GTTCCTGCAGAAAAAGGCAAAG, 3'-CTGAGGTGCCCATGCTACATTT), matrix metalloproteinase (MMP)-3 (5'ATGGAGCTGCAAGGGGTGAG, 3'-CCCGTCACCTCCAATCCAAG), ... 3'-CTGGTCTCAAGTCAGTGTACAGGTAA), CC chemokine ligand (CCL)5 (formerly called RANTES; 5'-CGCTGTCATCCTCATTGCTA, 3'-GCTGTCTCGAACTCCTGACC), CCL2 (formerly called MCP-1; 5'-GCCTCCAGCATGAAAGTCTC, 3'-TAAAACAGGGTGTCTGGGGA), ... fibroblast-like synoviocytes (FLS), and vascular endothelial cells, and probably play a pivotal role in the pathogenesis of RA [4-7] The cytokines IL-1 and TNF-α activate and can be activated by...
- 12
- 459
- 0
Báo cáo y học: "Two specific drugs, BMS-345541 and purvalanol A induce apoptosis of HTLV-1 infected cells through inhibition of the NF-kappaB and cell cycle pathways" ppsx
... leukemia Carcinogenesis 2005, 26:1382-1388 Watanabe M, Ohsugi T, Shoda M, Ishida T, Aizawa S, Maruyama-Nagai M, Utsunomiya A, Koga S, Yamada Y, Kamihira S, Okayama A, Kikuchi H, Uozumi K, Yamaguchi ... Higashihara M, Umezawa K, Watanabe T, Horie R: Dual targeting of transformed and untransformed HTLV-1-infected T cells by DHMEQ, a potent and selective inhibitor of NF-kappaB, as a strategy for ... induced caspase-3 and PARP cleavage in MT-2 and C8166 cells MT-2, C8166, and CEM were treated with Purvalanol A at various 0.1, 0.5, 1, and μM for 48 hr After 48 hr of treatment, total cell extracts...
- 16
- 391
- 0
Báo cáo y học: "Relative percentage and zonal distribution of mesenchymal progenitor cells in human osteoarthritic and normal cartilage" potx
... contributed to acquisition of data, analysis and interpretation of data, and drafting and critical revision of the manuscript SR contributed to acquisition of data and critical revision of the manuscript ... cartilage repair Materials and methods Cartilage preparation Human osteoarthritis (OA) cartilage was obtained from the knee joints of 11 patients who had high-grade OA and who underwent total ... multi-lineage potential in differentiation assays and then analyzed by FACS as above Page of 15 Cell differentiation assays For adipogenic differentiation, CD166+ and CD166- cells from patients with OA...
- 15
- 370
- 0
Báo cáo y học: " Effect of erythropoietin on level of circulating endothelial progenitor cells and outcome in patients after acute ischemic stroke" ppsx
... NIHSS, national institutes of health stroke scale Univariate and multivariate analyses of predictors for 90-day MANE Univariate analysis of enrollment variables in Tables and demonstrated that serum ... 90-day MANE Univariate and multivariate analyses of predictors for 90day combined end point (recurrent stroke or death) Univariate analysis of enrollment variables in Tables and demonstrated that ... hemoglobin, and biochemical data were acquired at 48 h and on days and 21 after acute IS The radiological diagnosis of acute IS included brain computed tomography showing a new finding of low attenuation...
- 11
- 350
- 0
Báo cáo y học: "Translational control plays a prominent role in the hepatocytic differentiation of HepaRG liver progenitor cells" docx
... Lyon, France) for the gift of the HepaRG cells We also thank Deepak Kolippakkam and Neha Lohia for assistance in data analysis and Paul Farley for assistance in the preparation of the manuscript ... Transcriptional, translational, and post-translational regulation of HNF1α and HNF4α during HepaRG cell differentiation Figure Transcriptional, translational, and post-translational regulation of HNF1α and ... and polysomal of the array data by on sucrose gradient Validation Validation of the array data by real time PCR (a) using total and polysome-bound RNA populations and (b) using individual fractions...
- 14
- 384
- 0
Differentiation and derivation of lineage committed chondroprogenitors and chondrogenic cells from human embryonic stem cells for cartilage tissue engineering and regeneration
... scalable expansion of the differentiated cells, phenotypic stability of differentiated cells and tissues, delivery systems and biomaterials for cartilage repair, and survivability and integration ... 2.1 Articular cartilage and its associated clinical problems Articular cartilage is a unique avascular, aneural and alymphatic load-bearing tissue which is supported by the underlying subchondral ... LIST OF ABBREVIATIONS Alkaline phosphatase - ALP Alcian blue - AB Alpha fetoprotein - AFP / αFP Autologous chondrocyte implantation - ACI Ascorbic acid 2-phosphate - AA2P β-actin - BA Bone marrow...
- 190
- 471
- 0
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
... 51:189-197 A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Validation of a behavioral pain scale in critically ill, sedated, and mechanically ventilated patients Anesth Analg 2005, 101:1470-1476 ... Zeggwagh AA, Abidi K, Madani N, Abouqal R: Measurement properties of the short form 36 and health-related quality of life after intensive care in Morocco Acta Anaesthesiol Scand 2007, 51:189-197 A ssaoui ... presented as the mean ± standard deviation for variables with a normal distribution, and as the median and interquartile range for variables with skewed distributions Parametric or nonparametric...
- 10
- 597
- 0
Báo cáo y học: "A pilot study of rizatriptan and visually-induced motion sickness in migraineu"
... migraine Headache 2001;41:604-5 Prakash S, Chavda BV, Mandalia H, Dhawan R, Padmanabhan D Headaches related to triptans therapy in patients of migrainous vertigo J Headache Pain 2008;9(3):185-8 Marcus ... Number Age Gender Aura/No Aura Diagnosis 32 39 37 Female Female Female Aura No Aura Aura Vertigo Vertigo Non-Vertigo 10 23 40 29 41 43 26 33 Female Female Female Female Female Female Female Aura Aura ... sweating, increased salivation, drowsiness, headache, and dizziness with eyes open and closed Severity of abnormalities in each category are rated by the subject and technician, with a range of...
- 6
- 504
- 0
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)
... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... (từ thû ấy/ đến nay), thû (từ thû ấy/ đến giờ) V a rút gọn v a đảo trật tự câu nghi vấn tính chất, đặc điểm: bao cao (cao bao nhiêu), bao dai (dài bao nhiêu), bao lớn (lớn bao nhiêu)… Rút gọn, ... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia,...
- 137
- 853
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25