a new marker for kidney disease use of cystatin c to identify it
Báo cáo y học: "Proliferation and differentiation potential of chondrocytes from osteoarthritic patients" ppt
... assays-on-demand (20× assay mixes) The gene-specific primers and probes for type II collagen 5'-TGG TGT CAA AGG TCA CAG AGG TTAT-3', antisense 5'-GGA ACC ACT CTC ACC CTT CACA-3', probe 5'-TCC ... Osteoarthritis Cartilage 2002, 10:564-572 Dozin B, Malpeli M, Camardella L, Cancedda R, Pietrangelo A: Response of young, aged and osteoarthritic human articular chondrocytes to inflammatory cytokines: ... step towards cell-based treatments for OA, that culture-expanded cells from patients diagnosed for OA have the capacity to proliferate and produce matrix proteins in the same quantity as ACT chondrocytes...
- 9
- 416
- 0
Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 2
... basal level of SPHK activity in these cells 52 Chapter2 Development and Evaluation of Human SPHK Inhibitors SPHK1 activity % over basal 150 C 5a C 5a +DMS 130 C 5a + CP1 C 5a + CP2 110 C 5a + CP3 C 5a ... in cell lysates It is a rapid and accurate method commonly used to determine the total protein concentration of a sample The assay is based on the notion that the absorbance maximum for an acidic ... study was to evaluate the compounds on PKC activity PepTag® assay for non-radioactive detection of PKC (Promega) was used This PKC assay is a non-radioactive assay, which utilizes fluorescent peptide...
- 32
- 310
- 0
Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 3
... cagccattgatacaggtagc FW: actaccatgagaattgcagtga RW: tcctcagaacttccagaatcag FW: ccacctggactacatcgg RW: tcctcatccctctcatacag FWD: aaccttagatgggggtgtcc RWD: gtggaagtgacgcctttca FWD: ccggtttatcaactggatgg RWD: ... related Lipoprotein lipase Leptin Primer sequence FW: atgctggctatgagcaggtc RW: gtgcagagacagcaggttca FW: ggaggaagctgtgaagatgc RW: gcacagcaacagtgagcagt FW: gcagagtccagcaaaggt RW: cagccattgatacaggtagc ... RWD: tggatcgaggccagtaattc FWD: tgacaccaaaaccctcatca RWD: atgaagtccaaaccggtgac Product size 101bp 139bp 70bp 70bp 109bp 123bp 145bp 102bp 3.1.4.3.2 PCR Standards Preparation Gel bands of the PCR products...
- 58
- 249
- 0
Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 4
... an arbitrary name, means marker Triplicate samples for each antibody were used 140 Chapter Role of S1P in human BM- and AD- MSCs proliferation It is shown in Table 4.1 that the cell surface markers ... directly act as an intracellular second messenger Both functions of S1P contributed to the intracellular calcium release, and P44/42-MAPK activation, which are tightly related to the stem cells ... After a stable calcium signal was obtained, 1μM or 10μM of S1P was added into the cuvette The calcium release results of human BM- and AD- MSCs at the different treatment conditions are summarized...
- 31
- 246
- 0
Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 5
... osteogenic/adipogenic differentiation The data described in chapter might also pave the way, for a more controlled and facilitate differentiation of stem cells, for future 154 Chapter Conclusion and ... type of MSC is quite obvious, as the cells are extracted from “unwanted” fat Also, the 156 Chapter Conclusion and Future Work procedure of extracting these cells is much less painful, compared with ... therapeutic applications to balance the abnormal portions of osteoblasts and adipocytes observed in bone diseases such as osteoporosis and osteopenia, where the bone volume is decreased but the adipose...
- 5
- 268
- 0
Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 6
... "Mesenchymal stem cells rescue CD34+ cells from radiation-induced apoptosis and sustain hematopoietic reconstitution after coculture and cografting in lethally irradiated baboons: is autologous ... derivative in a variety of human cancer cell lines.” Int J Cancer: 66,358-366 Taha, T A. , Y A Hannun, et al (2006) "Sphingosine kinase: biochemical and cellular regulation and role in disease. " ... "Characterization of a potential marker of corneal epithelial stem cells." Invest Ophthalmol Vis Sci 33(1): 143-52 Zohar, R., J Sodek, et al (1997) "Characterization of stromal progenitor cells...
- 25
- 467
- 0
Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation
... generates S1P, which can function as an intracellular mediator, as well as an extracellular mediator by binding to its receptors to stimulate various downstream signaling pathways, to regulate cell ... S1P can act as an intracellular second messenger and as an extracellular ligand for specific cell-surface receptors to regulate cell survival, in either case S1P has been shown to promote cell ... summary, this study aimed to develop and evaluate some novel and more specific inhibitors for human SPHK for research use, to compensate the current lack of specific inhibitors of SPHK commercially...
- 31
- 524
- 0
Control of Cell Proliferation and Growth byMyc Proteins
... indications that activation of Myc causes multiple problems for the cells, the clearest being that Myc can induce apoptosis or dramatically sensitize the cells to apoptotic stimuli Several mechanisms ... deregulation of Myc causes DNA damage: for example, cells in which Myc has been acutely activated stain positive for phosphorylated histone H2Ax and show foci of Mre11, indicative of doublestrand ... Lukas J, Bartek J (2005) DNA damage response as a candidate anti-cancer barrier in early human tumorigenesis Nature 434:864–870 Baudino TA, Maclean KH, Brennan J, Parganas E, Yang C, Aslanian A, ...
- 14
- 376
- 0
Tài liệu Báo cáo khoa học: a-Defensins increase lung fibroblast proliferation and collagen synthesis via the b-catenin signaling pathway doc
... target sequences for the mRNA of b-catenin were 5¢-AAAGCTGATATTGATGGACAG-3¢ The siRNA against luciferase mRNA was used as a control siRNA The target sequence for luciferase mRNA was 5¢-AACG TACGCGGAATACTTCGA-3¢ ... prevented b-catenin accumulates and translocates into the nucleus, forms a complex with T cell factor ⁄ lymphocyte enhancer factor-1 (TCF ⁄ LEF-1) family transcription factors, and regulates Wnt target ... 5¢-AACG TACGCGGAATACTTCGA-3¢ The siRNAs were customsynthesized by Qiagen (Valencia, CA, USA) and were transfected into lung fibroblasts using Qiagen RNAiFest transfection reagent in accordance with...
- 12
- 602
- 0
Cytoskeleton reorganization mediates alpha beta integrin-associated actions of laminin on proliferation and survival, but not on steroidogenesis of ovine granulosa cells pdf
... Research agencies (approval number A 37801) and conducted in accordance with the guidelines for Care and Use of Agricultural Animals in Agricultural Research and Teaching Experimental research was ... 40 20 0.1 Cytochalasin D ( g/ml) 10 b 60 a c (c) a a a 0.1 a 10 Cytochalasin D ( g/ml) Figure cytochalasin D on morphology of GC cultured on LN substratum Effect of2 Effect of cytochalasin D on ... c bc bc ab ab ab a a 0 0.1 0.1 10 d (c) 10 % Pyknotic cells % Labelled cells c bc bc ab a 10 Cytochalasin D ( g/ml) Cytochalasin D ( g/ml) ab 10000 20000 * bc 20000 c 40000 *** b (d) * a ab ab...
- 17
- 521
- 0
Báo cáo khoa học: Dehydroepiandrosterone inhibits the proliferation and induces the death of HPV-positive and HPV-negative cervical cancer cells through an androgen- and estrogen-receptor independent mechanism pptx
... cytotoxic than cytostatic Table Percentage of cells in each phase of the cell cycle as evaluated by flow cytometry Percentage of cells in the phases of the cellcycle G1 C3 3A CASKI HeLa DHEA induces apoptotic ... cervical cancer A TUNEL DAPI C3 3A Phase contrast Control Cisplatin DHEA B CASKI Control Cisplatin DHEA C HeLa Control Cisplatin DHEA 5602 Fig DHEA induces apoptotic death C3 3A (A) , CASKI (B) and ... antiproliferative effect of ceramide [34] Resistance to apoptosis and radiation in cervical cancers are also determined by transcription factors such as hypoxia inducible factor-1 alpha [35], and DHEA...
- 12
- 534
- 0
Báo cáo khoa học: G protein-coupled receptor-induced Akt activity in cellular proliferation and apoptosis pptx
... of cell cycle regulatory proteins [11], and its ability to inactivate pro-apoptotic factors, such as Bad, caspase-9 and forkhead (FH) transcription factors [12] In contrast, it is thought that ... Akt mediation of GPCR-induced survival and anti-apoptotic pathways A key role of Akt is to facilitate cell survival and to prevent apoptotic cell death In fact, dominant negative alleles of Akt ... phosphorylation and inactivation of pro-apoptotic factors such as Bad, caspase-9 and FH transcription factors Bad belongs to the Bcl2 family of apoptotic proteins In some cell types, unphosphorylated...
- 12
- 392
- 0
Báo cáo khoa học: Endogenous mono-ADP-ribosylation mediates smooth muscle cell proliferation and migration via protein kinase N-dependent induction of c-fos expression potx
... oligodeoxynucleotide primers speci c for GAPDH (sense: 5¢-CGGTGTG AACGGATTTGGCCGTAT-3¢, antisense: 5¢-AGCCTTC TCCATGGTGGTGAAGAC-3¢); c- fos (sense: 5¢-GAATA AGATGGCTGCAGCCAAGTGC-3¢, antisense: 5¢-AAG GAAGACGTGTAAGCAGTGCAGC-3¢), ... GAAGACGTGTAAGCAGTGCAGC-3¢), and c- myc (sense: 5¢-AAGTTGGACAGTGGCAGGGT-3¢, antisense: 5¢-TTGCTCCTCTGCTTGGACAG-3¢) Amplification was conducted over 35 cycles using a three-step program as described ... Parke-Davis Other chemicals, including mitogens and ADP-ribosylation inhibitors, were purchased from Sigma-Aldrich Silica G thin layer chromatography plates were from Whatman Phospho-speci c antibodies...
- 10
- 389
- 0
Báo cáo khoa học: Extraenzymatic functions of the dipeptidyl peptidase IV-related proteins DP8 and DP9 in cell adhesion, migration and apoptosis doc
... GGC CCA GAA CGG TCC GAC GGC TGG GCC CTG TCC CGA TGC CTG CCC Size GAC) ACC) TTC GAC GGC ATA GCC TTC GGC GTA AAT CCT AGG TGC CTA GGC GAA GGC CTA GGC GCA CTA ATG AAG TGG CCA GCA TCG CGG CCA ACA GAT ... TGG CCA GCA TCG CGG CCA ACA GAT GCC AGG AGG GCC GCC GTC GGG GCC TGG ATC ACC TAT ATA GTG GCC GGC CTT ATG CAG ACT ACC TCC CAG CAA TG TTT AGA GC GGG TGT AG C G C G 35 35 30 32 mer mer mer mer 25 ... integrins and ⁄ or DDR1 DPIV and FAP, although cell-surface molecules, are also cytoplasmically expressed and so may have similar cytoplasmic actions to DP8 and DP9 The recent discovery that cytoplasmic...
- 14
- 280
- 0
Báo cáo khoa học: Cleavage of focal adhesion proteins and PKCd during lovastatin-induced apoptosis in spontaneously immortalized rat brain neuroblasts ppt
... effect of lovastatin on FAK and p130Cas cleavage was due to its speci c inhibitory action on intracellular mevalonate synthesis The cleavage of FAK and p130Cas in response to various apoptotic ... cell–matrix contact is an important cell survival factor and the loss of cell–matrix and cell– cell contact is a characteristic feature of apoptosis [16] Focal adhesion complexes consist of integrin ... lovastatin-induced caspase-3 activation in neuronal cells may be cell type speci c To examine the contribution of caspases to cleavage of focal adhesion proteins and PKCd induced by lovastatin, pharmacological...
- 13
- 364
- 0
Báo cáo khoa học: Lipid droplet and milk lipid globule membrane associated placental protein 17b (PP17b) is involved in apoptotic and differentiation processes of human epithelial cervical carcinoma cells pptx
... were measured in apoptotic conditions, treating cells with carboplatin, 5-fluorouracil, irinotecan, mitomycin or paclitaxel in clinically achievable concentrations, in various dose–time combinations ... (g) keratinocyte speci c factors, AP-2, GCF and PAX-2 [49]; (h) factors abundant in placenta, AHR [50], AP-2 and PPARc; (i) proliferation and/or apoptosis regulators, AP-2, c- MYC [51] and NF-jB; ... myristate acetate (PMA) for 48 h There were cells incubated with 0.1 lM PKC inhibitor or 0.36 lM PKA inhibitor (10 · Ki in each cases) parallel to treatments with paclitaxel, dbcAMP or PMA Subcellular...
- 13
- 371
- 0
Adhesion science and engineering volume 2, the mechanics of adhesion surfaces, chemistry applicat
... in contact form an 'electrical double layer', analogous to a capacitor Electrical discharges may be observed when the surfaces are separated Electrical double layers are generally formed at liquid/solid ... increases the surface area across which intermolecular forces act, and it may induce microstructural changes (possibly increased crystallinity) in the cured adhesive, both of which may act to increase ... difficult to 24 J .C Berg Table Critical surface tension data for low-energy surfaces of varying surface chemistry obtained from Zisman plots Surface Surface chemical structure Critical surface...
- 1,226
- 1,200
- 0
Báo cáo sinh học: "Protein kinase CK2a is overexpressed in colorectal cancer and modulates cell proliferation and invasion via regulating EMT-related genes" docx
... invasion Figure Immunohistochemical detection of CK 2a expression in colorectal cancers, adenomas and adjacent normal colorectal mucosa Staining was (A) negative in normal colorectal epithelium cells, ... (104 with CRC and 40 with colorectal adenoma) Staining for CK 2a was nearly negative in all of the normal Page of 11 colorectal epithelium samples (Figure 1A) , and nuclear staining for CK 2a was extremely ... p21, C- myc and GAPDH expression in cells transfected with CK 2a- specific siRNA was detected by western blot analysis intestinal mucosa to adenoma (adenomatous mucosa) and finally to adenocarcinoma...
- 11
- 382
- 0
báo cáo hóa học:" Effect of borax on immune cell proliferation and sister chromatid exchange in human chromosomes Malinee Pongsavee" docx
... detection of DNA interchange This technic is used as a sensitive means of monitoring DNA damage It is useful for assessing the cytogenic impact of clastogenic agents on chromosomes It can be performed ... mg/ml to 0.6 mg/ml borax concentrations gave comparable results and the cytotoxicity index (CI) was calculated for each borax concentration The borax concentration of 0.6 mg/ml had the most effectiveness ... myoepithelial cells after exposure to lamda-carrageenan Cancer Res 1997, 57:2823–2826 Marcus SN, Marcus AJ, Marcus R, Ewen SWB and Watt J: The preulcerative phase of carrageenan-induced colonic ulceration...
- 6
- 580
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25