Chapter Roles of SPHK Inhibitors in Human BM- and AD- MSCs Differentiation CHAPTER ROLES OF SPHK INHIBITORS IN HUMAN BMAND AD- MSCS DIFFERENTIATION Human stem cells are more and more becoming the research focus for their use in developmental biology and for their potential in clinical applications, to replace or replenish destroyed or dysfunctional tissue/organ However, one of the major risks using stem cells for therapy is their spontaneous differentiation ability to form teratoma in the body (Wakitani et al., 2003; Vogel, 2005; Nussbaum et al., 2007; Hentze et al., 2007) Therefore, promoting stem cells differentiation in a controlled manner will be highly desirable to reduce the risk of teratoma formation Currently, there are several strategies to induce stem cells to differentiate along certain lineages, introduced in Section 1.4.5.2 Exogenous Cytokines and Growth Factors, Nonproteinaceous Cocktails, Scaffold, Co-culture, or Genetic Modification for MSCs Differentiation However, these methods share several common limitations such as prolonged culture duration, high cost, inability to consistently differentiate stem cells along specific lineages, risk of pathogen transmission and the use of controversial genetic engineering techniques such as viral vector constructs to introduce proliferative and/or lineage-specific genes Therefore, it is of wide interest to obtain more knowledge on the molecule(s) that promote stem cells differentiation in order to develop novel and safer strategies for stem cells differentiation In our study, inhibition of the enzyme SPHK, which is tightly related to the cells proliferation, was evaluated as a new strategy to promote human MSCs differentiation It is well known that proliferation and differentiation are two of the most fundamental biological processes in the life cycle of the stem cells, and there is a balance between 64 Chapter Roles of SPHK Inhibitors in Human BM- and AD- MSCs Differentiation them that determines cell fate When the balance is broken, the cells would grow without differentiation, or commit into differentiation Based on the proliferative role of SPHK, which has been introduced in Chapter 1, we hypothesized that when suppressing SPHK activity in the stem cells, the balance between proliferation and differentiation could be lost, the cell growth was arrested, and the cells would then enter into certain differentiation pathway(s) This hypothesis was supported by a recent study by Pébay et al (2005), which showed that S1P could work synergetically with PDGF to promote human embryonic stem cells proliferation, while the inhibition of SPHK by DMS, abolished the stemness maintained by S1P+PDGF and caused the cells to spontaneously differentiate, to unknown and uncharacterized lineage(s) However, no further research was carried out For example, it is not known what kinds of cells those human embryonic stem cells were differentiated into, or whether SPHK inhibition may aid the stem cells to differentiate into a specific cell-type(s) In Chapter I introduced the development of novel SPHK inhibitors, and the evaluation showed that the compounds generated were specific for SPHK1 Among these synthetic compounds, CP6 showed to be the best inhibitor candidate, in terms of the ability to penetrate into the cells and inhibit the endogenous SPHK1 and the good yield obtained from the chemical synthesis procedure Therefore, in this chapter, CP6 was selected to study the function of SPHK in human BM-MSCs and AD-MSCs differentiation, and the non-specific SPHK inhibitor, DMS, was used as a control Two differentiation pathways were chosen to study, namely, osteogenic and adipogenic differentiation, as these are well characterized pathways in human BM- and AD- MSCs differentiation 65 Chapter Roles of SPHK Inhibitors in Human BM- and AD- MSCs Differentiation 3.1 MATERIALS AND METHODS All chemicals, if not specially mentioned, were purchased from Sigma-Aldrich, Singapore 3.1.1 Cell culture 3.1.1.1 Human AD-MSCs First, human adipose tissue was obtained from Prof Dietmar W Hutmacher’s laboratory at the National University of Singapore, who had a protocol approved by the Institutional Review Board, National University Hospital, Singapore, for the procurement of human adipose tissue The adipose tissue was obtained from donors, after full written consent was obtained, who underwent elective liposuction Then, a modified cell isolation protocol, based on Zuk et al.’s (2001) method, was used to process the adipose tissues Briefly, the tissues were first washed three times with phosphate buffered saline solution (PBS) to remove the blood within the adipose tissues Tissues were then digested with 0.075% collagenase Type I (GIBCO #17101-015) for hours at 37°C with occasional shaking The mixture was then spun down at 300g for 10 minutes The digested tissue was separated into three layers with the cells at the bottom layer The top layers were discarded and the cells were then re-suspended in culture media containing high glucose DMEM (GIBCO, #10569) supplemented with 10% heatinactivated FBS (GIBCO), 1% of 2mM L-glutamine, 10mg/ml streptomycin and 10U/ml penicillin, and plated in 20 ml culture flasks (TPP, Trasadingen, Switzerland) Once the cells were attached to the culture flask, the medium was changed to remove the unattached cells Half of the growth medium was changed every three days Cells are cultured in an incubator at 37°C, 5% CO2 in a water-saturated environment 66 Chapter Roles of SPHK Inhibitors in Human BM- and AD- MSCs Differentiation 3.1.1.2 Human BM-MSCs Human BM-MSCs were a kind gift from Prof Michael Raghunath, who had purchased them from Cambrex (Cambrex, USA) Briefly, the cells were obtained from BM withdrawn from the posterior iliac crest of pelvic bone of normal volunteers (healthy males and non-pregnant females between the ages of 18 and 45 years old) Human BMMSCs were cultured in low glucose DMEM (GIBCO, #10567), supplemented with 10% FBS, 1% of 2mM L-glutamine, 10mg/ml streptomycin and 10U/ml penicillin Cells were cultured in an incubator at 37°C, 5% CO2 in a water-saturated environment 3.1.1.3 Stem Cells Seeding Density Unless otherwise stated, stem cell seeding density used was 5,000cells/cm2 in all of the experiments using human BM- and AD- MSCs 3.1.1.4 Stem Cells Osteogenic and Adipogenic Induction Culture Condition Normal growth Adipogenic differentiation Osteogenic differentiation Culture media DMEM+10% FBS +1% Penicillin and Streptomycin DMEM+10% FBS +1% Penicillin and Streptomycin Supplements N/A 0.5mM isobutyl-methylxanthine, 1μM dexamethasone, 10μM insulin, 200μM indomethacin, 1% Penicillin and Streptomycin DMEM+10% FBS 0.01μM 1,25-dihydroxyvitamin D3, 50μM +1% Penicillin and ascorbate-2-phosphate, 10mM ßStreptomycin glycerophosphate 3.1.1.5 Human Fetal Osteoblast Progenitor (hFOB) Cell Line The hFOB cell line is a clonal, conditionally immortalized human fetal cell line that is capable of osteoblastic differentiation and bone formation It was used as a positive control in MSCs osteogenic differentiation investigations The cells were cultured in 67 Chapter Roles of SPHK Inhibitors in Human BM- and AD- MSCs Differentiation RPMI 1640 supplemented with 10% FBS (GIBCO, Invitrogen Singapore), 2mM glutamine, 10U/ml penicillin and 10mg/ml streptomycin at 37C, 5% carbon dioxide in a humidified atmosphere 3.1.2 Cell Lysis Cell lysates were prepared by lysing the cells in RIPA buffer (0.01M Tris-HCl [pH 7.4], 0.15M NaCl, 1% sodium deoxycholate, 1% Nonidet P-40, 0.1% sodium dodecyl sulfate [SDS], 1mM EDTA, 1mM phenylmethylsulfonyl fluoride) for one hour at 4°C 3.1.3 Staining 3.1.3.1 Alizarin Red S Staining Alizarin Red S staining is widely used to evaluate the calcium-rich deposits generated by cells In this study, the staining was used to detect the mineralization in human MSCs during osteogenic differentiation Briefly, the induced cells were fixed in 10% formalin overnight at 4°C Alizarin Red S working solution was prepared by dissolving grams of Alizarin Red S powder (Sigma-Aldrich #05600) in 100ml of distilled water The pH of the working solution was adjusted to 4.1-4.3 using 0.5% ammonium After discarding the formalin and washed twice with distilled water, Alizarin Red S working solution was added to fully cover the fixed cells Cells were then incubated at room temperature for minutes and checked under microscope for the orange-red color to develop Excess dye was removed and the cells were washed three times with distilled water Alizarin Red S staining in each sample was quantified by dissolving the staining with diH2O and detecting the absorbance under 500nm 68 Chapter Roles of SPHK Inhibitors in Human BM- and AD- MSCs Differentiation 3.1.3.2 Oil Red O Staining Oil red O staining is commonly used to identify the exogenous or endogenous lipid deposits In the present study, it was used to detect the adipogenic differentiation of the human stem cells Briefly, cells were fixed in 10% formalin overnight at 4°C Oil Red O stock solution was prepared by dissolving 0.7 gram of Oil Red O powder (SigmaAldrich #O-0625) in 200ml isopropanol, followed by filtration A working solution was prepared by mixing six parts of the Oil Red O stock solution and four parts of distilled water After the formalin was removed, samples were washed with 60% isopropanol, and Oil Red O working solution was added and incubated for 10 minutes at room temperature Following the incubation the dye was removed and the cells were washed three times with distilled water Oil Red O staining in each sample was quantified by dissolving the staining with 100% of isopropanol and detecting the absorbance at 500nm 3.1.3.3 Fluorescence Immunostaining Fluorescence immunostaining was used to detect the expression of three typical osteogenic differentiation proteins: osteocalcin, osteopontin, and osteonectin In brief, cells cultured in different conditions were fixed in 100% methanol (in 48 well plates) at -20°C for at least 24 hours, blocked by 1% BSA in TBS-T (0.05%), and probed with primary and secondary antibodies The primary antibodies against bone matrix proteins used were: rabbit anti-human osteocalcin (Chemicon, #AB1858) (1:500 dilution); rabbit anti-human osteopontin (Chemicon, #AB1870) (1:500 dilution), and rabbit anti-human osteonectin (Chemicon, #AB1858) (1:1000 dilution) The secondary antibody used was 69 Chapter Roles of SPHK Inhibitors in Human BM- and AD- MSCs Differentiation goat anti-rabbit IgG (Pierce, #31460) (1:5000 dilution) Antibodies were all diluted in 1% BSA in TBS-T (0.05%) 3.1.4 Gene Level Expression Detection 3.1.4.1 RNA Extraction RNA was extracted from different samples and purified using RNeasy Mini Kit (QIAGEN, #74106) according to the manufacturer’s instructions; purified RNA samples were stored at -80°C until further use 3.1.4.2 Reverse Transcriptional PCR Purified RNA was reverse transcribed to cDNA using MuLV reverse transcriptase RNase H (Fermentas, #EP0451) according to the manufacturer’s instructions Based on the optimized conditions, initially, RNA was mixed with master mix which contained Oligo dT primers and incubated at 75°C for minutes, then immediately chilled on ice This is called the ‘first-strand reaction’ in RT-PCR The ratio of master mix components used is shown below: component Poly dT primers RNA Water (RNase free) Total reaction (μl) 1μl 10ng (depends on RNA volume) 13μl Afterwards, master mix was prepared and added into each reaction tube Reactions were incubated at 37°C for 60 minutes, and heated at 95°C for minutes to deactivate the reverse transcriptase This is the ‘second-strand reaction’ in the reverse transcription PCR The ratio of each component for master mix is shown below 70 Chapter Roles of SPHK Inhibitors in Human BM- and AD- MSCs Differentiation Component dNTP master mix (10Mm) RNase free inhibitor x M-MuLV reaction buffer M-MuLV reverse transcriptase Total reaction (μl) 1 (1μl for 10 reactions) (1ul for 10 reactions) 7ul 3.1.4.3 Real Time PCR The quantitative real time PCR used in this study was followed the protocol developed by Leong et al (2007) This is a novel method using linear double-stranded DNA molecules as the standards instead of using the typical gene-in-plasmid format Standards for different genes were obtained from the serial dilutions of the cDNA got from the reverse transcription PCR The exact numbers of DNA copies in the standards was calculated by the method introduced in Section 3.1.4.3.2 below Three dilutions of the standards (such as 1x104copies/μl, 1x105copies/μl, and 1x106copies/μl) were used for testing the mRNA expression of each gene Thus, using the standards as controls, the copy numbers of mRNA expressed in the sample could be calculated More details are addressed below 3.1.4.3.1 Primers Design Primers for genes of interest were designed according to their cDNA sequences from PubMed The uniqueness of the suitable pairs chosen was checked by “blast” (http://www.ncbi.nlm.nih.gov/blast/) All primers were purchased from Research BioLab (Singapore) With the designed primers, cDNA from different samples were amplified by PCR, and verified based on their size in a 2% agarose gel under UV illumination The genes and corresponding primers information is listed below 71 Chapter Roles of SPHK Inhibitors in Human BM- and AD- MSCs Differentiation Human SPHKs Gene SPHK1 SPHK2 Osteogenic Osteocalcin differentiation related Osteopontin Osteonectin Adipogenic Fatty acid binding differentiation protein related Lipoprotein lipase Leptin Primer sequence FW: atgctggctatgagcaggtc RW: gtgcagagacagcaggttca FW: ggaggaagctgtgaagatgc RW: gcacagcaacagtgagcagt FW: gcagagtccagcaaaggt RW: cagccattgatacaggtagc FW: actaccatgagaattgcagtga RW: tcctcagaacttccagaatcag FW: ccacctggactacatcgg RW: tcctcatccctctcatacag FWD: aaccttagatgggggtgtcc RWD: gtggaagtgacgcctttca FWD: ccggtttatcaactggatgg RWD: tggatcgaggccagtaattc FWD: tgacaccaaaaccctcatca RWD: atgaagtccaaaccggtgac Product size 101bp 139bp 70bp 70bp 109bp 123bp 145bp 102bp 3.1.4.3.2 PCR Standards Preparation Gel bands of the PCR products of the different genes were excised by a blade under UV DNA was extracted and purified using a DNA extraction kit (Fermentas, #K0513) according to the manufacturer’s instructions Briefly, gel segments which contained the DNA were incubated with 6M sodium iodide solution, which could bind DNA, at 55°C for 5-10 minutes, until the gel dissolved Silica powder suspension was added and the entire solution was mixed by vortexing, and incubated for 5-10 minutes at 55°C The silica powder/DNA mixture was centrifuged at 10,000g Pellets collected were washed three times with the washing buffer provided in the kit, which contained unstated concentrations of Tris, NaCl and EDTA DNA was eluted by incubating the pellets with suitable amount of sterile deionized water at 55°C, and quantified with a spectrophotometer (NanoDrop ND-1000) All of the 55°C incubation period stated above could vary, based on the estimated amount of processing DNA Copies of the 72 Chapter Roles of SPHK Inhibitors in Human BM- and AD- MSCs Differentiation DNA molecules in the different samples were calculated based on the knowledge of the average mass of a base pair The calculation method is addressed below: The average mass of a base pair in DNA is about 615 dalton according to their structures (see table below); a dalton (Da), named in honor of the British chemist John Dalton (1766-1844), is equivalent to 1/12 the mass of the 12C which equals 1.66053873E-27 kg, i.e., Da = atomic mass unit Average Nucleotide Mass DNA Sub-Unit Da 10-21g dAdenosine Monophosphate (A) 312.2 0.5184 Thymidine Monophosphate (T) 301.2 0.5001 Guanosine Monophosphate (G) 328.2 0.5450 dCytidine Monophosphate (C) 288.2 0.4785 Molecular Formula C10H11N5O5P C10H10N2O7P C10H11N5O6P C9H11N3O6P For calculation, if a designed PCR product is 100bp, and the purified DNA concentration is 10ng/μl, copies of DNA in this sample is calculated in the following way: 1) Since the PCR product is double strand DNA, and the designed size is 100bp, the mass of one copy of DNA is: average mass/base pair x size of product = 615x100=61500 (Da), which is equivalent to 61500x1.66053873E-27≈1.02E-22 (kg) In other words, one molecule of a designed double strand DNA weighs around 1.02E-22 kg 2) 1μl of DNA solution contains 10ng DNA, which means, 1μl of DNA solution contains 10ng/1.02E-22kg≈1011 (copies of molecules) Serial dilutions were made to generate standards for real time PCR 73 Chapter Roles of SPHK Inhibitors in Human BM- and AD- MSCs Differentiation Figure 3.9A and Figure 3.9B show the lipid droplets staining quantification in adipogenic-induced human BM-MSCs Human BM-MSCs cultured in the adipogenic differentiation media (AD) did not show any staining increment over that from noninduced control (ctrl) cells in both and 14 days cultures (Figure 3.9A: AD vs ctrl; Figure 3.9B, AD vs ctrl) However, after days of culture, the cells grown in the presence of either 1μM of DMS, 0.5μM of CP6, 1μM of CP6, or 5μM of CP6, showed more lipid droplets staining than that from the cells cultured without the inhibitors (Figure 3.9A: AD+1μM DMS vs AD, P