a do you noodles yes i noodles you rice no i rice
hoa duoc
... Titratable Acidity 95 A Preparation and Standardization of Base and Acid Solutions 97 B Titratable Acidity and pH 99 13 Fat Characterization 103 A B C D E Saponification Value 105 Iodine Value 106 ... evaluate the skill of the user as well as the reliability of the instrument and glassware Determining mass using an analytical balance is the most basic measurement made in an analytical laboratory ... technique With proper caliư bration and technique, accuracy and precision are limited only by the readability of the balance Repeatedly weighing a standard weight can yield valuable information about...
- 171
- 2,080
- 0
INTERNATIONAL STANDARD Microbiology of food and animal feeding stuffs — Horizontal method for the detection of Salmonella spp docx
... glassware Disposable apparatus is an acceptable alternative to reusable glassware if it has suitable specifications Usual microbiological laboratory equipment (see ISO 7218) and, in particular, ... several O-antigens are available commercially; i. e anti-sera containing one or more “O” groups (called monovalent or polyvalent anti-O sera), anti-Vi sera, and anti-sera containing antibodies ... valid International Standards ISO 6887-1, Microbiology of food and animal feeding stuffs — Preparation of test samples, initial suspension and decimal dilutions for microbiological examination...
- 34
- 690
- 0
Báo cáo khoa học: "A Generalized-Zero-Preserving Method for Compact Encoding of Concept Lattices" pot
... is an optimal solution to the original problem Simplifying the instances First of all, we only use minimum cardinality constraints |Si | ≥ ri for maximal types; and every ri ≥ λ + Given a feasible ... (typically by an approximate factor of two) It appears that in intuitive terms, the lexicographic bounds rarely narrowed the domains of variables much until the variables were almost entirely labelled ... assigning λ bits 1515 shared among all types; adding enough unshared new bits to maximal elements to satisfy cardinality constraints; adding one new bit to each nonmaximal meet irreducible type; and...
- 10
- 410
- 0
Báo cáo khoa học: "a Method for Automatic Evaluation of Machine Translation" pot
... exhibits far fewer matches, and their extent is less It is clear that a program can rank Candidate higher than Candidate simply by comparing ngram matches between each candidate translation and ... these possible choices, but not all Indeed, recalling all choices leads to a bad translation Here is an example Example 4: Candidate 1: I always invariably perpetually Candidate 2: I always Reference ... and divided by the total number of candidate ngrams In Example 1, Candidate achieves a modified bigram precision of 10/17, whereas the lower quality Candidate achieves a modified bigram precision...
- 8
- 336
- 0
![Standard Test Method for Compressive Strength of Hydraulic Cement Mortars (Using 2-in. or [50-mm] Cube Specimens)](https://media.store123doc.com/images/document/14/rc/yi/small_yil1395845738.jpg)
Standard Test Method for Compressive Strength of Hydraulic Cement Mortars (Using 2-in. or [50-mm] Cube Specimens)
... (Mandatory Information) A1 ANALYSES OF TEST RESULTS FOR QUALIFICATION OF ALTERNATE COMPACTION METHODS A1 .1 Calculation of Average Within-Batch Standard Deviation and Elimination of Outliers—Tabulate ... demonstrate an acceptable qualification The limits have been established statistically from analyses of historical CCRL data and are given in Table A1 .4 s%ML,n I (Nr−1)SDr2 Nrv – intermediate calculation, ... Compression machines shall be verified in accordance with Practices E4 at least annually to determine if indicated loads, with and without the maximum load indicator (when so equipped), are accurate...
- 10
- 851
- 0
Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot
... semantic similarities using a large amount of Web data in Japanese and show that the proposed measure gives better word similarities than a non-Bayesian Bhattacharyya coefficient or other well-known ... and Shaul Markovitch 1995 Contextual word similarity and estimation from sparse data Computer, Speech and Language, 9:123–152 Keiji Shinzato, Tomohide Shibata, Daisuke Kawahara, Chikara Hashimoto, ... p(v(wi )), by Bayesian estimation and then take the expectation of the original similarity under this distribution as follows: simb (w1 , w2 ) Background 2.1 Bayesian estimation with Dirichlet prior...
- 10
- 472
- 0
a novel method for the synthesis of titania nanotubes using
... titanium samples are designated in the main text as UAT and SAT, respectively 2.3 Annealing of the materials Fig Experimental setup for anodization of titanium using ultrasonic treatment of nanotubes ... shows predominantly anatase TiO2 [9,22,23] DRUV–vis spectra of the as-anodized and annealed titania nanotubes are shown in Fig 10 It can be seen that the titania nanotubes annealed under N2 atmosphere ... monitored continuously using a digital multimeter (METEX, MXD The anodized titania nanotubular arrays were annealed in a nitrogen and oxygen atmosphere at 500 ◦ C for h in a CVD furnace at a heating...
- 8
- 634
- 0
a novel method for the synthesis of cao nanoparticle
... contaminates In recent years, nanocrystalline is often used, either natural or synthetic, with inorganic metal oxides as solid reactive some affinity for metals catalyst sorbents instead of liquid ... width at half via X-ray diffraction (XRD) measurement maximum (FWHM), and θ is the Bragg (Figure 2) The average particle size of diffraction angle The average particles size nanoparticles was ... decomposition applications of Co-Precipitation in the absence and presence nanosized metal oxides such as AP-MgO, AP- of Polyvinylpyrrolidone (PVP) as a capping CuO, AP-Fe2O3, AP-Al2O3 and AP-CaO...
- 12
- 705
- 0
solgel based hydrothermal method for the synthesis of 3d flowerlike zno microstructures
... [43] R Wahab, A Mishra, S .I Yun, I. H Hwang, J Mussarat, A A Al-Khedhairy, Y.S Kim, H.S Shin, Fabrication, growth mechanism and antibacterial activity of ZnO micro-spheres prepared via solution process, ... 3D ZnO hierarchical architectures provide an effective means of maintaining high specific surface area and preventing aggregation during photocatalytic reaction processes, leading to enhanced ... hierarchical ZnO architectures: photocatalytic and antibacterial activities, CrystEngComm 15 (2013) 4631-4639 [29] M.V Vaishampayan, I S Mulla, S S Joshi, Optical and Photocatalytic Properties...
- 26
- 551
- 0
báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot
... preparation of the manuscript PIF and AES participated in the cutting and staining of Page of the bone tissue RGR participated in the planning of the experiments, data analysis and the preparation ... detectable marrow LDH viability staining (data not shown) Osteocyte survival was determined and quantified at higher magnification Presence of formazan crystals within osteocytes demonstrating cellular ... origin, biowest) Viability was analyzed using a lactate dehydrogenase (LDH) assay [4], with a day non-culture group to provide baseline viability levels Harvested explants were cut with a Leica annular...
- 4
- 403
- 0
báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" pot
... causes mild pain during strenuous activities 24 Usually is painful after strenuous activities only 18 Is occasionally painful during routine activities 12 Is painful during walking 06 Position of heel ... complications Functional assessments included: gait, functional limitation, shoe wear, pain and patient satisfaction We not include radiological assessment in our study The Ponseti scoring system ... functional results was used, with Page of 100 points indicating a normal foot This includes a maximum score of 30 points for amount of pain; of 20 points each for level of activity and patient satisfaction;...
- 7
- 531
- 0
báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" docx
... causes mild pain during strenuous activities 24 Usually is painful after strenuous activities only 18 Is occasionally painful during routine activities 12 Is painful during walking 06 Position of heel ... complications Functional assessments included: gait, functional limitation, shoe wear, pain and patient satisfaction We not include radiological assessment in our study The Ponseti scoring system ... functional results was used, with Page of 100 points indicating a normal foot This includes a maximum score of 30 points for amount of pain; of 20 points each for level of activity and patient satisfaction;...
- 7
- 802
- 0
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt
... Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 Type-specific PCR upper primer TGT GCT GCC ATA TCT ACT TCA GAA ACT AC Type-specific PCR lower primer TAG ACC AAA ATT CCA GTC ... cutoff value and validation of QDs and superparamagnetic nanoparticle-based hybridization 3-Aminopropyl-trimethoxysilane (APTMS) modification and coupling process of superparamagnetic nanoparticles ... nanoparticles Table Hybridization probes and type-specific PCR primers Sequence Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3...
- 9
- 469
- 0
Báo cáo hóa học: " A relaxed hybrid steepest descent method for common solutions of generalized mixed equilibrium problems and fixed point problems" potx
... submission Rigorous peer review Immediate publication on acceptance Open access: articles freely available online High visibility within the field Retaining the copyright to your article Submit your ... generalized mixed equilibrium problems and variational inequalities, for relaxed cocoercive mapping in Hilbert spaces Abstr Appl Anal 2010, 39 (2010) Article ID 390972 Jaiboon, C: The hybrid steepest ... Faculty of Liberal Arts, Rajamangala University of Technology Rattanakosin (Rmutr), Bangkok 10100, Thailand 3Centre of Excellence in Mathematics, Che, Si Ayuthaya Road, Bangkok 10400, Thailand...
- 20
- 350
- 0
Báo cáo hóa học: " Research Article The Shrinking Projection Method for Common Solutions of Generalized Mixed Equilibrium Problems and Fixed Point Problems for Strictly Pseudocontractive Mappings" ppt
... Zegeye and N Shahzad, “Approximating common solution of variationalinequality problems for two monotone mappings in Banach spaces,” Optimization Letters In press 26 A Tada and W Takahashi, “Weak and ... Kumam, C Jaiboon, P Kumam, and A Singta, A shrinking projection method for generalized mixed equilibrium problems, variational inclusion problems and a finite family of quasinonexpansive mappings,” ... problems in Hilbert spaces,” Journal of Mathematical Analysis and Applications, vol 331, no 1, pp 506–515, 2007 P Hartman and G Stampacchia, “On some non-linear elliptic differential-functional equations,”...
- 25
- 495
- 0
Báo cáo hóa học: " Research Article Hybrid Method for a Class of Stochastic Bi-Criteria Optimization Problems" docx
... the satisfaction degree of decision maker The basic idea of this algorithm is to adjust the three-level parameters of decision maker until a satisfactory solution is obtained It is noted that, ... the last section Reformulation of Stochastic Bi-Criteria Model by Hybrid Approach In this section, we are going to reformulate the original stochastic bi-criteria problem into a deterministic problem ... probability as higher as possible.For the Journal of Inequalities and Applications general stochastic constraints A w x ≥ b w , we obtain their deterministic formulations by expectation method as done...
- 12
- 387
- 0
Báo cáo hóa học: " Research Article A General Projection Method for a System of Relaxed Cocoercive Variational Inequalities in Hilbert Spaces" pot
... cocoercive variational inequalities in Hilbert spaces,” Applied Mathematics Letters, vol 20, no 3, pp 329– 334, 2007 [4] F Giannessi and A Maugeri, Eds., Variational Inequalities and Network Equilibrium ... quadratic programming, and variational problems In this paper, we consider, based on the projection method, the approximation solvability of a system of nonlinear relaxed cocoercive variational ... China; Department of Mathematics, Shijiazhuang University, Shijiazhuang 050035, China Email address: meijuanshang@yahoo.com.cn Yongfu Su: Department of Mathematics, Tianjin Polytechinc University,...
- 9
- 256
- 0
A FUNCTIONAL-ANALYTIC METHOD FOR THE STUDY OF DIFFERENCE EQUATIONS EUGENIA N. PETROPOULOU AND potx
... preceding operator equation and obtain information for the initial linear difference equation under consideration In the case of nonlinear equations, we some manipulation in order to write the operator ... depending on the initial conditions and the nonhomogeneous term (if any) of the initial nonlinear difference equation, and φ : H1 → H1 is a known nonlinear mapping At this point, we impose conditions ... consideration into an equivalent linear or nonlinear operator equation in an abstract separable Hilbert H or Banach H1 space Then, after some manipulations, we bring the linear operator equation into...
- 12
- 257
- 0
A MODIFIED QUASI-BOUNDARY VALUE METHOD FOR A CLASS OF ABSTRACT PARABOLIC ILL-POSED PROBLEMS M. pot
... Regularization of parabolic ill-posed problems A similar approach known as the method of auxiliary boundary conditions was given in [6, 9] Also, we have to mention that the non standard conditions ... the initial condition for evolution operator-differential equations, Vestnik Belorusskogo Gosudarstvennogo Universiteta Seriya Fizika, Matematika, Informatika (1998), no 2, 60–63, 81 (Russian) ... Denche and K Bessila, A modified quasi-boundary value method for ill-posed problems, Journal of Mathematical Analysis and Applications 301 (2005), no 2, 419–426 [6] V K Ivanov, I V Mel’nikova, and A...
- 8
- 256
- 0
Radio Occultation Method for Remote Sensing of the Atmosphere and Ionosphere docx
... noticeable variations in the amplitude of RO signal Analysis of CHAMP data indicates importance of the amplitude variations for classification of the ionospheric influence on RO signals This classification ... considered at the initial stages of investigations Theoretical estimations of the atmospheric and ionospheric influence on radio waves propagation in the communication link satellite-to-satellite ... navigational satellite systems GLONASS and GPS for achieving the high resolution and stability relative to the noise and interferences, the noise-like signals with phase-manipulation are applied...
- 176
- 302
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25