0

7 habits of a highly successful trader

Tài liệu 7 Habits of a Highly Successful Trader doc

Tài liệu 7 Habits of a Highly Successful Trader doc

Kỹ năng bán hàng

... write?) Reading Market Wizards I and II it was a prominent feature I noticedwith all top traders. They never saw the markets as a cash box but simplyas a way of operating a business. the name of the ... face the thought of making a come-backAsk these questions:* What annual rate of return do I want?* Do I want to trade full time, part time, hardly any time?* Can I handle the stress of day ... work at whatreally works in the market and NOT keep chasing the latest hot newtrading idea that exploits peoples love of money to make them act. I am amazed at the number of traders who have...
  • 31
  • 468
  • 0
Tài liệu 7 Habits Of A Higly Sucsessfull Trader pptx

Tài liệu 7 Habits Of A Higly Sucsessfull Trader pptx

Kỹ năng quản lý

... 7 Habits of a Highly Successful Trader Mark Crisphttp://www.stressfreetrading.com 7. Keep trading as Part of a Balanced life: Trading be it successfully or not, is a very stressful career. ... write?) Reading Market Wizards I and II it was a prominent feature I noticedwith all top traders. They never saw the markets as a cash box but simplyas a way of operating a business. the name of the ... you are a long term trend follower then why ask a day trader? If you are a value investor then asking a momentum trader will be a total waste of time. What I am saying is, no two people have...
  • 31
  • 423
  • 0
Tài liệu 7 Habits of Highly Effective People (Stephen Covey) ppt

Tài liệu 7 Habits of Highly Effective People (Stephen Covey) ppt

Anh ngữ phổ thông

... it's not a case of reading for its own sake; it is reading carefully selected material which allows you to broaden and deepen your understanding. You will naturally be paying particular attention ... who have already internalised the opposite habit as a part of their personalities. For some people, the glass is always half-empty and the feeling of melancholy is a pleasant reminder that something ... understand the other party and do that first; finally creatively brainstorm a synergistic solution - a natural product of mutual understanding and respect.Habit 7 - Sharpen the SawBe Proactive...
  • 6
  • 671
  • 3
7 habits of websavvy entrepreneurs

7 habits of websavvy entrepreneurs

Thương mại điện tử

... inc.comhttp://www.inc.com/ilya-pozin /7- habits- of- web-savvy-entrepreneurs.html?nav=next 7 Habits of Web-Savvy EntrepreneursWeb-savvy people always know the latest tech trends and they can get more work done faster than ... it's time to adopt a few new habits: 1. Become an email ninja.Are you one of those people who spends more time communicating about a project than actually doingthe project? Stop. Only allow yourself ... Brogan, or Guy Kawasaki, all haveone thing in common. They maintain a very active blog. At the end of the day, this is where your onlinehome base resides.If you want to succeed online, get a...
  • 2
  • 231
  • 0
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

Báo cáo khoa học

... zinc-metalloproteinase from Serratia marcescens. BiochimBiophys Acta 955, 77 –85.6 Oda T, Kojima Y, Akaike T, Ijiri S, Molla A & MaedaH (1990) Inactivation of chemotactic activity of C 5a bythe serratial ... 56-kilodalton protease. Infect Immun 58,1269–1 272 . 7 Tanaka H, Yamamoto T, Shibuya Y, Nishino N,Tanase S, Miyauchi Y & Kambara T (1992) Activation of human plasma prekallikrein by Pseudomonas aerugi-nosa ... arrows, A1 A5 ) in the sequence of insulin chain A. (B) Change over time in the chromatographicpeak area of cleavage fragments. Note that the amount of frag-ments A1 , A2 and A4 decreases on...
  • 11
  • 424
  • 0
Báo cáo khoa học: Mechanistic investigation of a highly active phosphite dehydrogenase mutant and its application for NADPH regeneration pptx

Báo cáo khoa học: Mechanistic investigation of a highly active phosphite dehydrogenase mutant and its application for NADPH regeneration pptx

Báo cáo khoa học

... 2¢- and3¢-hydroxyl groups of the adenine ribose moiety of NAD in WT PTDH, and an Arg replaced Ala 176 tostabilize the additional negative charge of NADP.PTDH-E 175 AA 176 R displayed relaxed cofactor ... University of Illinois at Urbana-Champaign, Urbana, IL, USA2 Department of Chemical and Biomolecular Engineering, University of Illinois at Urbana-Champaign, Urbana, IL, USA3 Department of Biochemistry, ... cellular supply of cofactors,or the cofactors are regenerated in situ using a sacrifi-cial substrate. Several reviews discuss the availablemethods and benefits of regeneration of a number of cofactors...
  • 12
  • 368
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx

Hóa học - Dầu khí

... |||||||||||||||| | || ||| AcMNPV 1484 AAGCCCGACACCATGAAGCTGGTAGTAAACTGGAGCGGCAAAGAGTTTCTCAGGGAAACT 1543 SpliNPV 64 TGGACCCGTTTCATGGAAGACAGCTTCCCCATCGTGAACGATCAAGAAGTGATGGACGTG 123 ||||||||||||||||||||||||||||| ... |||||||| || ||||||| AcMNPV 172 3 CGT-GTACGTAGGAAACAACAACGAATACCGCATCAGCCTGGCCAAGAAGGGCGGCGGCT 178 1 SpliNPV 302 GTCCC-GTGATGAACCTGCACGCCGAATACAC-CACTTCGTTTGA-GAGTTTCATCGACA 358 | ||| || |||||||| ... |||||| | ||||||||| AcMNPV 1544 TGGACCCGTTTCATGGAAGACAGCTTCCCTATCGTGAACGACCAAGAAATTATGGACGTG 1603 SpliNPV 124 TTTCTAGTGGTGAACATGCGTCCCACTAGACCGAACCGTTGCTTT-AGATTTTTGGCGCA 182 || |||||| | ||||||...
  • 11
  • 854
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Complete genome sequence of a highly divergent astrovirus isolated from a child with acute diarrhea" ppt

Hóa học - Dầu khí

... turkeyastroviruses [22]. A bipartite NLS is characterized as hav-ing two regions of basic amino acids separated by a 10 aaspacer. The protein alignment of ORF 1a revealed thatAstV-MLB1 has a sequence ... to:HAstV-1HAstV-2HAstV-3HAstV-4HAstV-5HAstV-6HAstV -7 HAstV-8TAstV-1TAstV-2TAstV-3ChAstV-1OAstV MAstV 1a 78 7 28 28 NA 29 29 NA NA 29 9 9 NA 10 22 241b 511 54 54 NA 54 54 NA ... region of ORF 1a that has homology to a peptidase domain. In addition, alignment of AstV-MLB1with other astroviruses revealed that AstV-MLB1 containsthe amino acids of the catalytic triad (His, Asp,...
  • 7
  • 341
  • 0
Diary of a Professional Commodity Trader: Lessons from 21 Weeks of Real Trading_1 ppt

Diary of a Professional Commodity Trader: Lessons from 21 Weeks of Real Trading_1 ppt

Tài chính doanh nghiệp

... Managed Account Research Inc. web site.Part II: Characteristics of a Successful Trading Plan Chapter 2: Building a Trading Plan Trader Personality andTemperament Adequate Capitalization ... Proprietary Trading Record For the active trading years of 1981–1995 (including fouryears when I granted power of attorney to another trader) and again starting in 20 07, my average annual rate of return ... 1. I am a real trader who trades real markets inreal time with real money. I am not anacademician or a person who relies on the sale of books to pay my mortgage. I am not selling a trading...
  • 24
  • 455
  • 5
Diary of a Professional Commodity Trader: Lessons from 21 Weeks of Real Trading_2 pdf

Diary of a Professional Commodity Trader: Lessons from 21 Weeks of Real Trading_2 pdf

Tài chính doanh nghiệp

... The idea that chart patterns are reliablypredictive of future price behavior is foolhardy at best.Charts are a trading tool, not a forecasting tool. As a trader who has used charts for market ... quick-fixsystems and approaches as a means to easy profits are a dishonor to the real-life challenges of trading. Second, I want to communicate to nontraders andtraders still early in their journey ... profitabilitythat trading requires a comprehensive approachaddressing far, far more than simply having a belief that a certain market is going to advance or decline. Trading is a business that...
  • 24
  • 695
  • 1
Diary of a Professional Commodity Trader: Lessons from 21 Weeks of Real Trading_3 pptx

Diary of a Professional Commodity Trader: Lessons from 21 Weeks of Real Trading_3 pptx

Tài chính doanh nghiệp

... whether a trader uses a mechanical ordiscretionary technical approach, a supply-and-demandfundamental approach, or an economic model. Lack of certainty if a market is or is not setting up a trade ... are dictated primarily by howrisk is managed. Many novice commodity traders assumeeach trade will be a winner. Professional traders managetheir trading to assume that each trade may be a loser.Obviously, ... technical approach used by the Factor Trading Planfalls into a category known as discretionary (as opposed tothe mechanical approach used by many technical traders). A discretionary trading plan...
  • 24
  • 381
  • 0
Diary of a Professional Commodity Trader: Lessons from 21 Weeks of Real Trading_4 potx

Diary of a Professional Commodity Trader: Lessons from 21 Weeks of Real Trading_4 potx

Tài chính doanh nghiệp

... simply a means A continuation pattern during the course of a major trendallows me to advance my initial protective stop in thedirection of a profitable trade. A breakout of a continuationchart ... professionaltrading career was dedicated to advancing a moreconservative approach to futures trading. Donchian passedaway in the early 1990s. The Weekend Rule basically states that a market thatdecisively ... graph of theAustralian dollar/Japanese yen (AUD/JPY). Again note theretest that occurred two weeks after the initial patterncompletion. As is almost always the case with valid patternbreakouts,...
  • 24
  • 349
  • 0
Diary of a Professional Commodity Trader: Lessons from 21 Weeks of Real Trading_6 doc

Diary of a Professional Commodity Trader: Lessons from 21 Weeks of Real Trading_6 doc

Tài chính doanh nghiệp

... thedetermination of the risks and leverage taken on any tradeor combination of trades, trade order management dealswith the actual physical process of entering and exitingtrades. My job as a trader ... me as a trader. And this is a battle that never ends. Existing Open Positions Among all aspects of my trading, this is the one area thatcauses me the most aggravation and stress. How to handle a ... direction. A choppy market does damage financially. Choppymarkets can impose emotional and confidenceconsequences on a trader that are far worse. I can’tthree significant weekly chart patterns that...
  • 24
  • 238
  • 0

Xem thêm