5 human embryonic stem cells
Báo cáo y học: "Low temperature tolerance of human embryonic stem cells"
... storage of human embryonic stem cells Stem Cells 2004;22 (5) :779-89 10 Speicher MR, Ballard SG, Ward DC Karyotyping human chromosomes by combinatorial multi-fluor FISH Nat Genet 1996; 12:368–3 75 129 ... VS, Jones JM Embryonic stem cell lines derived from human blastocysts Science 1998;282 (53 91):11 45- 7 Reubinoff BE, Pera MF, Fong CY, Trounson A, Bongso A Embryonic stem cell lines from human blastocysts: ... 94 .5% , 3.0% and 2 .5% respectively for 24h exposure to 4oC (n=200); and 97 .5% , 1.0% and 1 .5% respectively for 24h exposure to 25oC (n=200) The proportion of Grade A, B and C colonies were 95. 5%,...
- 6
- 477
- 0
báo cáo hóa học:" Transplantation of vascular cells derived from human embryonic stem cells contributes to vascular regeneration after stroke in mice" docx
... FCS and expanded by about 85- fold after passages The expanded cells at 5th passage were constituted with two cell fractions One of these cells was VE-cadherin+ cells ( 35 50 %), which were positive ... from human ES cells (HES-3) Characterization of the transplanted vascular cells derived from human ES cells (HES-3) A, Flow cytometric analysis of VE-cadherin and VEGF-R2 expression on human ES cells ... suggest that vascular cells derived from human ES cells may have a potential to be a source for therapeutic vascular regeneration after stroke Abbreviations ES cells: Embryonic stem cells; VEGF-R2:...
- 14
- 450
- 0
báo cáo hóa học:" MicroRNA and gene expression patterns in the differentiation of human embryonic stem cells" doc
... miRNAs in this cluster; they were miR -51 5-5p, miR517a, miR -51 7b, miR -51 7c, miR -51 9e, miR -52 0b, miR520d, miR -52 0f, miR -52 0h, miR -52 1, miR -52 5-3p, and miR -52 6b* The similar expression levels of ... miR -52 0d miR -52 6b* miR -52 5 miR -51 8b miR -52 0a miR-324-3p miR-29a miR-29b miR-29c miR-132 miR- 155 miR -59 6 miR-4 95 miR-376a miR-368 miR-181a miR-27a miR-125a miR-22 miR-143 miR-23a miR-21 miR-125b let-7g ... pluripotency and early embryonic development by the tran- http://www.translational-medicine.com/content/7/1/20 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 Nat Cell Biol 2006,...
- 17
- 593
- 0
báo cáo hóa học:" Human embryonic stem cells hemangioblast express HLA-antigens" pot
... CCAGGAGCTTGAAGTTCTCAGGAT AGCTTAGTGATACTTGTGGGCCAG 129 144 196 196 219 216 159 104 282 282 304 370 302 59 59 59 59 59 59 59 59 60 60 59 59 59 Page of 10 (page number not for citation purposes) Journal of ... MHC proteins in human embryonic stem cells Proc Natl Acad Sci USA 2002, 99( 15) :9864-9 Li L, Baroja ML, Majumdar A, Chadwick K, Rouleau A, Gallacher L, et al.: Human embryonic stem cells possess ... engraftment of mouse embryonic stem cells in allogeneic recipients Stem Cells 2006, 24(10):2192-201 Magliocca JF, Held IK, Odorico JS: Undifferentiated murine embryonic stem cells cannot induce...
- 10
- 409
- 0
Báo cáo khoa học: "Human embryonic stem cells and therapeutic cloning" pdf
... embryonic stem cells and therapeutic cloning (LIF) Dev Biol 1990, 141, 344- 352 53 Pera MF, Trounson AO Human embryonic stem cells: prospects for development Development 2004, 131, 55 155 5 25 54 Pesce ... Proc Natl Acad Sci USA 1978, 75, 55 65- 556 9 70 Sottile V, Thomson A, McWhir J In vitro osteogenic differentiation of human ES cells Cloning Stem Cells 2003, 5, 149- 155 71 Spemann H Ver Deutsch Zool ... to mouse ES cells, isolation of ES cells have been attempted rats [30], mink [ 75] , rabbits [22], hamster [ 15, 56], primates [78], sheep [55 , 25] , cattle [20,73], and pigs [55 ,50 ,21,76, 45] A wide...
- 10
- 403
- 0
báo cáo khoa học: "Epigenomics of human embryonic stem cells and induced pluripotent stem cells: insights into pluripotency and implications for disease" potx
... prevalent in embryonic stem cells and may be mediated by DNA methyltransferase 3a Proc Natl Acad Sci U S A 2000, 97 :52 37 -52 42 72 Altun G, Loring JF, Laurent LC: DNA methylation in embryonic stem cells ... pluripotent stem cells and embryonic stem cells are distinguished by gene expression signatures Cell Stem Cell 2009, 5: 111-123 93 Chin MH, Pellegrini M, Plath K, Lowry WE: Molecular analyses of human ... cancer-specific CpG island shores distinguishes human induced pluripotent stem cells, embryonic stem cells and fibroblasts Nat Genet 2009, 41:1 350 -1 353 101 Santenard A, Ziegler-Birling C, Koch M,...
- 13
- 338
- 0
Differentiation and derivation of lineage committed chondroprogenitors and chondrogenic cells from human embryonic stem cells for cartilage tissue engineering and regeneration
... chondrogenic cells ……….119 CHAPTER 5 DISCUSSION…………………………………………………………… 121 5. 1 PHASE I: MODEL SYSTEM…………………………………………… 121 5. 1.1 Human ESCs as a model system to study chondrogenesis………… 121 5. 1.1.1 ... Hours - hr Human- specific vimentin - hVIM Human embryonic stem cells - hESCs Human ESC-derived chondrogenic cell-engineered cartilage - HCCEC Human palate mesenchymal cell line - HPM Human umbilical ... CHONDROGENIC CELLS …………… 133 5. 3.1 Human ESC-derived chondrogenic cells ……………………… 133 5. 3.1.1 Effects of growth factors and ECM on hESC-derived chondrogenic cells ……………………………………………………………… 133 5. 4 PHASE...
- 190
- 471
- 0
Establishment of autologous culture systems for human embryonic stem cells
... of stem cells by derivation source Category Embryonic stem cells Embryonic germ cells Fetal stem cells Umbilical cord stem cells Umbilical cord blood stem cells Umbilical cord matrix stem cells ... embryonic germ cells, fetal stem cells, umbilical cord stem cells, adult stem cells and induced pluripotent stem (iPS) cells (Ariff Bongso, 20 05, see Table 2) Each type of stem cells holds its ... (Sorgner, 2007) Embryonic stem cells Mesenchymal stem cells, Hematopoietic stem cells Oligopotent Can differentiate into only a few cells (Sorgner, 2007) Lymphoid stem cells, Myeloid stem cells Unipotent...
- 214
- 481
- 0
Role of sonic hedgehog signalling in human embryonic stem cells and its neural derivatives
... events underlying human nervous system development (Ben-Nun and Benvenisty, 2006; Dvash et al., 2006) 2.7 Embryonic stem cells and induced pluripotent stem cells Embryonic stem cells (ESC) have ... conditioned media (CM) used for daily hESC culture feeding 3.2.3 Human embryonic stem cells and induced pluripotent stem cells Human embryonic stem cell line HES-3 (46, XX) was from ES Cell International ... conditioned media from !E-MEFs 33! 3.2.3! Human embryonic stem cells and induced pluripotent stem cells 33! 3.2.4! Embryoid body formation 33! 3.2 .5! Generation of stable cell lines ...
- 178
- 546
- 0
Baculovirus mediated genetic modification of human embryonic stem cells
... in the course of ex vivo gene therapy 1.1.1 Human Embryonic Stem Cells Human embryonic stem (hES) cells are cells derived from the inner cell mass of human blastocysts The hES cell research began ... system DMEM Dulbecco’s modified eagle’s medium EF1α elongation factor 1α eGFP enhanced green fluorescent protein ES cells FBS hES cells embryonic stem cells fetal bovine serum human embryonic stem ... achieve desirable level of transient transgene expression in human embryonic stem cells Efficient gene transfers to human embryonic stem cells were obtained after optimization of the promoters and...
- 135
- 218
- 0
The derivation, propagation, storage and gene expression of human embryonic stem cells on human feeders
... adult stem cells are the hematopoietic stem cells, mesechymal stem cells and neuronal stem cells Adult stem cells have also been isolated from several other organs such as the brain (neuronal stem ... (neuronal stem cells) , skin (epidermal stem cells) , eye (retinal stem cells) and gut (intestinal crypt stem cells) (Spradling et al 2001) However, 15 not all organs and tissues may contain stem cells ... cannot be performed in the human Animal embryonic stem cells Embryonic stem cells were first derived from certain strains of mice (Evans & Kaufman 1981) Embryonic stem cell lines have been established...
- 207
- 366
- 0
Directed differentiation of human embryonic stem cells into haematopoietic and definitive endodermal lineages
... μ – Mu ° – Degree x CHAPTER 1: GENERAL INTRODUCTION 1.1 Embryonic stem cells The isolation of mouse and human embryonic stem cells (ES cells) heralded a new era in regenerative medicine, raising ... culture of ICM cells with stem cell-like morphology from human blastocysts (Fig 1.1A) though cultures failed beyond passages The first long-term culture (4 -5 months) of human embryonic stem cells (hESCs) ... T cells 14 Figure 1 .5 Haematopoietic development Pluripotent stem cells give rise to multipotent haematopoietic stem cells that differentiate into lymphoid and myeloid progenitors T -cells, B-cells...
- 296
- 2,020
- 0
IN VIVO EX VIVO OSTEOGENESIS OF HUMAN EMBRYONIC STEM CELLS
... marrow (mesenchymal stem cells, hematopoietic stem cells) and (2) embryonic stem and embryonic germ cells derived from discarded human embryos and germ line stem cells Adult stem cells can be derived ... hESCs-dervied osteogenic cells in bone formation 21 CHAPTER MATERIAL & METHODS 22 2.1 MATERIAL & METHODS Culture and maintenance of Human Embryonic Stem Cells Human embryonic stem cells (hESCs) used ... (BioRad) Samples were amplified for 35 cycles at 95 C for minutes, 35 cycles at 95 C for 30 seconds, 55 - 65 C for 45 seconds, 72 C for minute, followed by 72 C for 25 minutes β-actin was the house...
- 77
- 972
- 0
Transcriptome study of human embryonic stem cells and knockdown study of a pluripotency marker, LIN28
... HES4 Human Embryonic Stem Cells SAGE _Embryonic_ stem_ cell_H9_normal_p38_CL_SHES1 LSAGE _Embryonic_ stem_ cell_BG01_normal_p20_CL_SHE19 LSAGE _Embryonic_ stem_ cell_H13_normal_p22_CL_SHE 15 LSAGE _Embryonic_ stem_ cell_H14_normal_p22_CL_SHE14 ... family Page X Chapter Introduction 1.1 Human embryonic stem cells 1.1.1 Overview and characteristics of human embryonic stem cells Embryonic stem (ES) cells are isolated from the inner cell mass ... 1.2 Human embryonic stem cells 1.1.1 Overview and characteristics of human embryonic stem cells 1.1.2 Regulatory networks and transcription factors in human ES cells 1.1.3 Induced pluripotent stem...
- 109
- 371
- 0
Human embryonic stem cells as a cellular model for osteogenesis in implant testing and drug discovery
... of stem cells, adult stem cells, embryonic stem cells and induced pluripotent stem cells, embryonic stem cells are inevitable and irreplaceable source to be studied Hence, for the projects 15 ... Biocompatibility 1.2 Stem cells ………………………………………………………………….4 1.2.1 Significance in the use of stem cells 1.2.2 Definition of stem cells 1.2.2.1 Adult stem cells 1.2.2.2 Embryonic stem cells 1.2.2.3 Induced ... the use of adult stem cells either in research or clinical applications 1.2.2.2 Embryonic stem cells: Another type of stem cells by conventional categorization is embryonic stem cells based on...
- 117
- 385
- 0
Human embryonic stem cells for genotoxicity testing
... METHODS…………………………………… 15 3.1 Cell Culture……………………………………………………………………… 15 3.11 Human Lung fibroblast culture………………………………………………… 15 3.12 Human embryonic stem cell (hESCs) culture…………………………… 15 3.13 Differentiation ... RESULTS……………………………………………………… 27 4.1 Characterization of human embryonic stem cells …………………… 27 4.2 Temperature tolerance of human embryonic stem cells …………… 30 4.21 Survival rate of hESC after exposure ... of Mitomycin C on human embryonic stem cells using PNA-FISH and mFISH………………………………………………… 41 CHAPTER 5 DISCUSSION…………………………………………………… 52 CHAPTER 6 CONCLUSION…………………………………………………… 56 CHAPTER 7 APPENDIX………………………………………………………… .57 ...
- 10
- 203
- 0
Báo cáo y học: " Human embryonic stem cell (hES) derived dendritic cells are functionally normal and are susceptible to HIV-1 infection" pot
... and embryonic stem cells to study human hematopoiesis Curr Opin Biotechnol 20 05, 16 :51 0 -51 5 Anderson JS, Bandi S, Kaufman DS, Akkina R: Derivation of normal macrophages from human embryonic stem ... enrichment of cardiomyocytes derived from human embryonic stem cells Circ Res 2002, 91 :50 1 -50 8 He JQ, Ma Y, Lee Y, Thomson JA, Kamp TJ: Human embryonic stem cells develop into multiple types of cardiac ... from human embryonic stem cells Nat Biotechnol 2001, 19:1129-1133 Kaufman DS, Hanson ET, Lewis RL, Auerbach R, Thomson JA: Hematopoietic colony-forming cells derived from human embryonic stem cells...
- 9
- 261
- 0
Báo cáo y học: " Derivation of normal macrophages from human embryonic stem (hES) cells for applications in HIV gene therapy" pps
... infection in human T cells by lentiviral-mediated delivery of small http://www.retrovirology.com/content/3/1/24 46 47 48 49 50 51 52 53 54 55 56 57 58 interfering RNA against CCR5 Proc Natl Acad ... Mol Ther 20 05, 13 :5- 14 Pera MF, Trounson AO: Human embryonic stem cells: prospects for development Development 2004, 131 :55 15- 552 5 Keller G: Embryonic stem cell differentiation: emergenceof a new ... differentiation ofhuman embryonic stem cells Blood 2003, 102:906-9 15 Wang L, Li L, Menendez P, Cerdan C, Bhatia M: Human embryonic stem cells maintained in the absence of mouse embryonic fibroblasts...
- 11
- 340
- 0
Báo cáo y học: "Identification and isolation of embryonic stem cells in reproductive endocrinology: theoretical protocols for conservation of human embryos derived from in vitro fertilization" ppsx
... facilitate human ESC research and to promote respect for human embryos obtained from clinical reproductive endocrinology practice http://www.tbiomed.com/content/2/1/ 25 Human embryonic stem cells: ... Medical Modelling 20 05, 2: 25 http://www.tbiomed.com/content/2/1/ 25 Figure Experimental embryonic stem cell colonies derived from a single blastomere Experimental embryonic stem cell colonies derived ... Swiergiel JJ, Marshall VS, Jones JM: Embryonic stem cell lines derived from human blastocysts Science 1998, 282:11 45- 1147 Fischbach GD, Fischbach RL: Stem cells: science, policy, and ethics J...
- 8
- 368
- 0
Roles of long non coding RNAs in human embryonic stem cell pluripotency and neural differentiation 5
... Ontology Term GO:0001764 GO:000 859 3 GO:003 355 4 GO:0030900 GO:0022008 GO:00 457 47 GO:002 153 7 GO:0007266 GO:0007420 GO:0048709 p-value 5. 28E-06 6 .55 E-06 2.97E- 05 2.97E- 05 1.29E-04 1.46E-04 1.48E-04 ... Isolation and characterization of neural crest stem cells derived from in vitro-differentiated human embryonic stem cells Stem Cells Dev 18, 1 059 -1070 Johnson, R., Teh, C.H., Jia, H., Vanisri, ... stromal-derived inducing activity in the generation of dopaminergic neurons from human embryonic stem cells Stem Cells 26, 151 7- 152 5 Walker, E., Chang, W.Y., Hunkapiller, J., Cagney, G., Garcha, K., Torchia,...
- 34
- 316
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008