0

07 zebrafish a potential novel research tool for the analysis and modeling of anxiety

báo cáo khoa học:

báo cáo khoa học: " NorthStar, a support tool for the design and evaluation of quality improvement interventions in healthcare" ppt

Báo cáo khoa học

... Italy: Center for the Evaluation of Effectiveness of Health Care (Ce.V.E .A. S.), Modena Partner manager – Alessandro Liberati The Netherlands: Centre for Quality of Care Research, University of ... by a small sample size, the limited representativeness of participants, the lack of a comparison, and the assessment of intermediate outcomes For example, we have not evaluated the impact of the ... integrated and practical tool to assist QI researchers, healthcare professionals, and managers responsible for developing, delivering and evaluating CE and QI programmes at a national or regional level...
  • 7
  • 429
  • 0
Báo cáo y học:

Báo cáo y học: "yrGATE: a web-based gene-structure annotation tool for the identification and dissemination of eukaryotic genes" pdf

Báo cáo khoa học

... ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA CTCAAAAGCCTTTGAGCAGCAACTTCTTGATATGGGAGCAAAAGT TTCAAAAACTTTCAACAAGCGCGTGACACATGTAGTCTTCAAAGA TGGACATTCAACTACATGGAGAAAAGCACAGGATGCTGGTGTAAA blastn blastx tblastx Protein Coding Region Start ... 957488 ACTCGAGGATGACACTTCGGCCGATGAGGTACAAGTTTCTTCTATTTGTTTTGGAATAAAGTGTAATCGCCGTGCTTAATGATTTTCCCACAATCGATCAGCAGGATAAGGAGATTGATCTGCCAGAGTCCATT ACTCGAGGATGACACTTCGGCCGATGAG>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>CAGGATAAGGAGATTGATCTGCCAGAGTCC ... add Clear User-Defined Exons Table mRNA (1802 nucleotides) AGCACCGCGCAGGCGCTGCGGAGCCGCGCGGAGGAAGTTTGAACG GTGGCGGGTACCGGAGCCGCTGATGGAGTCCGTGCTGAAAGGTAT ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA...
  • 11
  • 467
  • 0
A framework for the analysis and assessment of accountability arrangements in the public domain

A framework for the analysis and assessment of accountability arrangements in the public domain

Tổng hợp

... Act, the Accountability for Presidential Gifts Act, and the Arafat Accountability Act, to the Polluter Accountability Act, the Syria Accountability Act, and the United Nations Voting Accountability ... forum could therefore also apply a collective strategy of accountability and pick any member of the organisation and hold it personally accountable for 18 the conduct of the organisation as a ... the availability of information about former and current administrative actions for the administrative body involved and a wider range of administrative bodies? b Does the accountability arrangement...
  • 37
  • 535
  • 0
Báo cáo y học:

Báo cáo y học: "An annotation infrastructure for the analysis and interpretation of Affymetrix exon array data" pot

Báo cáo khoa học

... software products for standard arrays, and their major analytical aims overlap with those available in exonmap and BioConductor/ R, that is, differential expression analysis and splicing analysis ... of the commercial software suites allow integration with the analytical libraries of R and all are proprietary and licensed, while the X:MAP database and exonmap are free and open source (available ... development of a single integrated database rather than building a database containing only probe and probeset hits, and making use of another external annotation resource such as EnsMart [20], BioMart...
  • 9
  • 598
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A TOOL FOR THE AUTOMATIC CREATION, EXTENSION OF LEXICAL KNOWLEDGE" pdf

Báo cáo khoa học

... verb form werkte (worked) (Records for citation forms contain pointers to the different forms belonging to their paradigm, and information relevant to all forms of a paradigm: e.g case frames and ... consists of the nucleus and coda of the last stressed syllable and the following weak syllables if any For example, the rhyme determining part of w~rrelea (to whirl) is er-ve-len, of versn6llea (to accelerate) ... is ~ d ~ to the system, and we want to add all inflected forms (the paradigm of the verb) to the dictionary with their pronunciation As a first hypothesis, the system assumes that the inflection...
  • 5
  • 467
  • 0
báo cáo hóa học:

báo cáo hóa học:" Research Article A New Technique for the Digitization and Restoration of Deteriorated Photographic Negatives" pptx

Hóa học - Dầu khí

... has created an urgent need for a technique that can capture the information in each of the negatives of a large collection before the damage causes a complete and irretrievable loss of information ... 125–135, 1997 E Prados, F Camilli, and O Faugeras, A unifying and rigorous shape from shading method adapted to realistic data and applications,” Journal of Mathematical Imaging and Vision, vol ... However, limited dynamic range of the CCD and quantization in the Analog/Digital conversion often lead to data loss that typically appears as saturation 6 EURASIP Journal on Image and Video Processing...
  • 13
  • 569
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Research Article On the Nonexistence and Existence of Solutions for a Fourth-Order Discrete Boundary Value Problem" doc

Hóa học - Dầu khí

... oscillatory properties of certain fourth order nonlinear difference equations,” Journal of Mathematical Analysis and Applications, vol 322, no 2, pp 930–956, 2006 13 E Thandapani and I M Arockiasamy, ... Bai and Y Xu, “Nontrivial solutions of boundary value problems of second-order difference equations,” Journal of Mathematical Analysis and Applications, vol 326, no 1, pp 297–302, 2 007 21 R P Agarwal, ... 2008 M Ruyun, Z Jihui, and F Shengmao, The method of lower and upper solutions for fourth-order two-point boundary value problems,” Journal of Mathematical Analysis and Applications, vol 215, no...
  • 18
  • 371
  • 0
báo cáo khoa học:

báo cáo khoa học: " The Rx for Change database: a first-in-class tool for optimal prescribing and medicines use" ppt

Báo cáo khoa học

... summary format for each review and ensures the accuracy of the information Analysis and synthesis We analyse, summarise, and report separately the results of all relevant comparisons within each ... evidence and ensures that the data is available to the general public, healthcare professionals, and policy makers Summary We created the Rx for Change database to facilitate and improve the processes ... design, data collection, analysis, coordination of the study, and drafted the manuscript RR, AM, JW, NS, DL, AS, and SH participated in the design, data collection, analysis, and coordination of the...
  • 9
  • 245
  • 0
báo cáo khoa học:

báo cáo khoa học: "Use of RE-AIM to develop a multi-media facilitation tool for the patient-centered medical home" potx

Báo cáo khoa học

... with the information, tools, and support they need to adopt healthy behaviors and take care of their health problems in their daily lives However, primary care clinicians and staff often lack training ... with the ongoing demands of chronic disease management The delivery of actionable information must be tailored to the patient’s capacity for change and the presence of emotional and distress-related ... clinicians and staff members; and discuss practical implications and directions for future research and practice 6 RE-AIM planning and evaluation framework RE-AIM was developed to help health planners...
  • 31
  • 351
  • 0
Báo cáo y học:

Báo cáo y học: " Identification of a novel motif responsible for the distinctive transforming activity of human T-cell leukemia virus (HTLV) type 1 Tax1 protein from HTLV-2 Tax2" pps

Báo cáo khoa học

... HTLV-4 are associated with any particular disease such as leukemia The amino acid sequence and the functional analysis of HTLV-3 Tax3 showed that Tax3 has a functional PBM, and is capable of interacting ... transforming activity of Tax1 The Tax1(185- 207) region negatively regulates the transforming activity of Tax1 (A) The amino acid sequences of the 185- 207 region of Tax1 The exchanged amino acids ... 80 Transformation (Number) 60 40 20 40 20 Tax 224 Tax 232 Tax Tax 300 Tax2B Tax2B Tax 207 Tax300 D) Tax 154 Tax232 Tax1 Tax224 Tax 207 Tax 207 Tax 184 Tax184 Tax154 Tax1 Tax1 Tax 154 Tax 207 B)...
  • 11
  • 548
  • 0
Báo cáo y học:

Báo cáo y học: "Anni 2.0: a multipurpose text-mining tool for the life sciences" ppt

Báo cáo khoa học

... feedback and contributed to the manuscript JK supervised the work and revised the manuscript Additional data files The following additional data are available Additional data file is a table ... innovative and useful features as described below Anni uses a concept-based approach Definitions for the concepts are available in the application, as well as links to external databases and ontological ... up-regulated in prostate metastases The clustering is based on the similarity of the concept profiles of the genes (b) A fragment of the annotation for cluster A The annotation view displays for a...
  • 10
  • 336
  • 0
Báo cáo y học:

Báo cáo y học: "ChIPOTle: a user-friendly tool for the analysis of ChIP-chip data" docx

Báo cáo khoa học

... above the significance cutoff, 'array density' of the peak, and the P value for that peak The array density value is defined as the average number of arrayed elements used to calculate the window ... with a standard deviation of 0.35 and a mean of (black bars) The upper and lower bounds of the black dashed line represent extreme values for 10,000 simulated Gaussian distributions with the above ... window values for all windows that comprise the peak Therefore, the array density value provides an estimate of the number of actual raw data measurements that underlie each peak Properties of ChIP-chip...
  • 8
  • 334
  • 0
The RAND Corporation is a nonprofit research organization providing objective analysis and effective solutions that address the challenges facing the public and private sectors around the world. potx

The RAND Corporation is a nonprofit research organization providing objective analysis and effective solutions that address the challenges facing the public and private sectors around the world. potx

Sức khỏe trẻ em

... state laws and state Medicaid contracts mandate communication and information-sharing regarding maternal and child health care services across physical and behavioral health care systems and between ... Resources A few programs have integrated data systems that enable case managers or care coordinators to track individual families and share data across programs Case managers and care coordinators can ... the local system of maternal and child health care The county has model programs of exceptional quality and professional staff and administrators who are dedicated to serving all members of the...
  • 79
  • 343
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

Điện - Điện tử

... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGCCTGTACCCAAGCATTATTCAGGCACACAATCTGTGT GTAGTTGACTTTGCCAGCTTGTACCCCAGCATCATCCAGGCTCATAATCTATGC ... QAHNA-GDTD1B TGV-IYG TGV-IYG6 DFASA-GDTD1B DFASA-GDTD1B AAC59452 (58aa) AAG21352 (58aa) AAG21351 (59aa) AAG 1078 3 (58aa) AAD56945 (59aa) AAC55644 (55aa) AAC59454 (156aa) AAC55645 (55aa) CAB61753 ... (151aa) CAB61754 (151aa) AAC55648 (55aa) AAD30141 (56aa) AAG23218 (158aa) AAC57974 (151aa) DFASA-GDTD1B AAF23082 (158aa) DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B...
  • 24
  • 604
  • 0
báo cáo hóa học:

báo cáo hóa học:" Tuberculosis and HIVNeeded: A New Paradigm for the Control and Management of Linked Epidemics" pot

Hóa học - Dầu khí

... integration of TB and HIV care and treatment are highly encouraging while at the same time their examples highlight the technical, programmatic, staffing and scale-up challenges that remain and ... current paradigm and a proposed alternative paradigm The current common paradigm is characterized by separate and distinct programs with little coordination or overlap The alternate paradigm emphasizes ... requires assessment of various models of collaboration and integration and their relevance to the specific setting These models may range from maintenance of separate programs and services with enhanced...
  • 5
  • 469
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Research Article WING/WORLD: An Open Experimental Toolkit for the Design and Deployment of IEEE " ppt

Hóa học - Dầu khí

... Communications and Networking stack, making the WMN appears just as another Ethernet link On the other hand, such an approach introduces additional encapsulation and processing overhead as a result of, ... measured data 2.2 Software Platforms A wide range of OSes is available for the aforementioned hardware platform, ranging from open-source systems like all Linux variants and ∗ BSD to commercial real-time ... Start Gateway and Start Relaying The former action sets the backhaul link associated with the new state as the default route to the Internet; moreover, the node starts advertising itself as candidate...
  • 17
  • 522
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article On the Existence and Convergence of Approximate Solutions for Equilibrium Problems in Banach Spaces" pot

Báo cáo khoa học

... N.-J Huang and C.-X Deng, “Auxiliary principle and iterative algorithms for generalized setvalued strongly nonlinear mixed variational-like inequalities,” Journal of Mathematical Analysis and Applications, ... Optimization, vol 52, no 3, pp 301–316, 2003 [9] E Cavazzuti, M Pappalardo, and M Passacantando, “Nash equilibria, variational inequalities, and dynamical systems,” Journal of Optimization Theory and ... Lions, and R Tr´ moli` res, Numerical Analysis of Variational Inequalities, e e vol of Studies in Mathematics and Its Applications, North-Holland, Amsterdam, The Netherlands, 1981 [21] M A Hanson,...
  • 14
  • 404
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A multiplex real-time PCR for differential detection and quantification of Salmonella spp., Salmonella enterica serovar Typhimurium and Enteritidis in meats" pps

Báo cáo khoa học

... SsA-F SsA-R SE-Cy5 aggccttcgggttgtaaagt gttagccggtgcttcttctg FAM-aaccgcagcaattgacgttaccc-BHQ 1a tgcagaaaattgatgctgct ttgcccaggttggtaatagc JOE-acctgggtgcggtacagaaccgt-BHQ 1a ggtaaaggggcttcggtatc ... for S Enteritidis) Although the multiplex real-time PCR assay was demonstrated as an applicable assay in artificially inoculated meats, it needs further research for natural meat cases and other ... at C The supernatant was carefully transferred to a new microcentrifuge tube and incubated again for 10 o at 100 C and placed immediately on ice An aliquot of μl of the supernatant was used as...
  • 9
  • 410
  • 0
Báo cáo y học:

Báo cáo y học: "The feasibility of axial and coronal combined imaging using multi-detector row computed tomography for the diagnosis and treatment of a primary spontaneous pneumothora" pps

Báo cáo khoa học

... along the bronchial trees Therefore cranio-caudal evaluation is necessary for accurate examination of ELCs HRCT is traditionally performed by axial imaging Although axial imaging has the advantage ... not in the surgical field, the suspected area was resected The final confirmation of ELCs was based on the pathology reports Axial and coronal HRCT protocol Data analysis The imaging parameters ... analyzed the number, location, and type of ELCs according to the MDCT data After analysis of the ELCs, a thoracic surgeon performed an axillary thoracotomy for direct inspection of the ELCs The operation...
  • 5
  • 657
  • 0

Xem thêm