0
  1. Trang chủ >
  2. Y Tế - Sức Khỏe >
  3. Y học thưởng thức >

Báo cáo y học: "Cell Cycle Arrest by a Natural Product via G2/M Checkpoint"

Tài liệu Báo cáo Y học: Oxidation of phenols by laccase and laccase-mediator systems doc

Tài liệu Báo cáo Y học: Oxidation of phenols by laccase and laccase-mediator systems doc

... that can specifically interact with target func-tional groups, through reaction pathways that are differentfrom those directly accessible to laccase. A foreseeablestrategy for any laccase-catalysed ... in a 10-mmquartz cuvette. Spectra were recorded in the 220–320 nmrange, and the absorbance at 280 nm was plotted againstconcentration.Oxidations catalysed by laccase and laccase/mediatorsystemsIn ... Oxidation of phenols by laccase and laccase-mediator systemsSolubility and steric issuesFrancesca d’Acunzo, Carlo Galli and Bernardo MasciDipartimento di Chimica and Centro CNR Meccanismi...
  • 6
  • 539
  • 0
Tài liệu Báo cáo Y học: Tissue factor pathway inhibitor A possible mechanism of action doc

Tài liệu Báo cáo Y học: Tissue factor pathway inhibitor A possible mechanism of action doc

... Veronica I. Zarnitsina and Fazoil I. AtaullakhanovNational Research Center for Hematology, Russian Academy of Medical Sciences, Moscow, RussiaWe have analyzed several mathematical models that describeinhibition ... VIIa–TF-dependent factor X activation by TFPI. We have comparedexperimental data obtained by Baugh et al. [8] with severalmathematical models of the process and have shown that: (a) the mechanism ... correlation:½VIIa À TF0/ KXaÀVIIaÀTFD¼kXaÀVIIaÀTFdkVIIaÀTF;Xa a A2 2ÞIn a similar fashion, the analysis of VIIa–TF inhibition by Xa–TFPI or with the help of hypothetical reaction...
  • 16
  • 415
  • 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

... primer 5¢-d(TATTTGCATGGCCAGCCCAATCTATTTGAG)-3¢; Gly262 to Ala, upperprimer 5¢-d(ATAGATTGGGGTGCCCATGCAAATAATGCA)-3¢, lower primer 5¢-d(ATTATTTGCATGGGCACCCCAATCTATTTG)-3¢; Tyr269 to Ala, upper ... primer5¢-d(TAATGCATCCGCTTTAATTTCTGAAATTAATG)-3¢, lower primer 5¢-d(TCAGAAATTAAAGCGGATGCATTATTTGCATG)-3¢.The upstream primer containing the NdeI restriction site(underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAAAAAATTG)-3¢ ... wereresidues Gly261 and Gly262. The replacement of Gly262 by Ala resulted in an inactive enzyme. Substitution of Gly261 by Ala resulted to an enzyme with lower stability andincreased energy of activation....
  • 6
  • 488
  • 0

Xem thêm

Từ khóa: báo cáo khoa học y họcbáo cáo y họcbáo cáo y học cổ truyềnbáo cáo y tế học đườngmẫu báo cáo y tế học đườngNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ