Franchising as a modern contractual realization of distribution (Particularly in Slovakia)
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT ... CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG ... ovarian carcinomas, colorectal carcinomas, esophageal carcinomas, bladder carcinomas and non-small cell lung carcinomas CA9 is strongly induced by hypoxia via the transcription factor hypoxia-inducible...
- 13
- 563
- 0
báo cáo hóa học:" Aberrant expression and potency as a cancer immunotherapy target of alpha-methylacyl-coenzyme A racemase in prostate cancer" pptx
... expression of β-actin mRNA and AMACR mRNA in prostate cancer line LNCaP, but only very weak expression of AMACR mRNA was observed in normal adult liver and pancreas (Figure 1A) In contrast, the AMACR ... immunohistochemical staining In contrast, PSA was stained in both prostate cancer tissue and non-cancerous tissue (Figure 2C) These data indicated that AMACR had a mostly cancer- specific expression profile at ... kind gifts from Takeda Pharmaceutical Co (Osaka, Japan), Ono Pharmaceutical Co (Osaka, Japan) and Novartis Pharmaceutical (Basel, Switzerland), respectively Human recombinant IL-7 was purchased...
- 11
- 531
- 0
Báo cáo y học: " Laugh syncope as a rare sub-type of the situational syncopes: a case report" potx
... conclusion Laugh syncope was diagnosed in the patient based on his characteristic presentation Situational syncopes such as laugh syncope are usually diagnosed using history from the patient [9] In the ... neurologic syncope were associated with an increased risk of death from any cause and an increased risk of cardiovascular events and stroke, respectively [15] By comparison, patients with vasovagal, ... orthostatic, medication-induced and situational syncope had no increase in the risk of death from any cause compared with patients without syncope [15] Although laugh syncope was not specifically addressed...
- 4
- 190
- 0
báo cáo khoa học:" Fanconi anemia manifesting as a squamous cell carcinoma of the hard palate: a case report" pptx
... The association of Fanconi' s anemia and squamous cell carcinoma Cancer 1983, 52:926-928 Kennedy AW, Hart WR: Multiple squamous- cell carcinomas in Fanconi' s anemia Cancer 1982, 50:811-814 Alter ... Buchwald M: Fanconi anemia revisited: old ideas and new advances Stem Cells 1994, 12:142-153 Linares M, Pastor E, Gomez A, Grau E: Hepatocellular carcinoma and squamous cell carcinoma in a patient ... Wanebo HJ, Cantrell RW: Squamous cell carcinoma in the immunosuppressed patient: Fanconi' s anemia Laryngoscope 1985, 95:771-775 Jansisyanont P, Pazoki A, Ord RA: Squamous cell carcinoma of the...
- 5
- 245
- 0
Báo cáo y học: " Vascular endothelial growth factor as a non-invasive marker of pulmonary vascular remodeling in patients with bronchitis-type of COPD" pot
... change in mPAP or PVR during exercise with breathing of oxygen as a parameter of pulmonary vascular remodeling Change in mPAP was significantly correlated with VEGF level in induced sputum from bronchitis-type ... evaluation of degree of pulmonary vascular remodeling in bronchitis-type patients Using both pulmonary hemodynamic study and histologically morphological analysis, Kubo and their colleagues have ... infiltrates in small airways, suggesting that an inflammatory process might also account for the vascular remodeling of pulmonary arteries [21,22] A potential mechanism for the increased number of inflammatory...
- 7
- 257
- 0
Property rights as investment incentives the contractual structure of rd activities in biopharmaceutical industry
... unified account of the costs and the benefits of integration In the PRT, integrating asset 25 ownership changes incentives, but does not result in coordinated investments as in the TCE Therefore, ... bargaining power of trading partners may have a profound impact on the allocation of property rights In the biopharmaceutical industry, financial constraints of a biotech firm weaken its bargaining position ... hypotheses about the R&D boundaries of a pharmaceutical company I then test those hypotheses in the context of the biopharmaceutical industry In Chapter 4, I study the allocation of property rights...
- 158
- 304
- 0
Identification and characterization of protein kinase CK2 as a novel interacting protein of neuronal CDK5 kinase and its functional role in microtubule dynamics
... acidic proteins (Hathaway and Traugh, 1982) Two distinct casein kinases have been found in many different cell types They have been designated casein kinase (CK1) and casein kinase (CK2) according ... Ca2+/calmodulin-dependent protein kinase II cAMP cyclic adenosine monophosphate Cdk cyclin-dependent kinase Cdk5 cyclin-dependent kinase cDNA complementary deoxyribonucleic acid CK1 casein kinase CK2 casein kinase ... interacting proteins Using the former approach, the catalytic α subunit of protein kinase CK2 (formerly known as casein kinase 2) was isolated from rat brain extracts The direct associations of CK2 with...
- 182
- 480
- 0
A Plasmonic Photocatalyst Consisting of Silver NanoparticlesEmbedded in Titanium Dioxide
... a fourth approach, namely plasmonic photocatalysis The idea of plasmonic photocatalysis is as follows TiO2 of anatase phase is a semiconductor with a band gap of 3.26 eV,12 so near UV irradiation ... photocatalysis Similar ideas were already outlined in the past.14,15 For example the photoinduced charging and dark discharging of a silver core as a means to modulate the surface plasmon band of Ag@TiO2 ... a further cardinal advantage of the present device is the ability to fabricate it as a large area photocatalytic material J AM CHEM SOC VOL 130, NO 5, 2008 1679 Awazu et al ARTICLES Acknowledgment...
- 5
- 344
- 0
A STUDY ON TRANSLATION OF DELIVERY TERMS IN INTERNATIONAL BUSINESS CONTRACTS
... 1999) Chapter three: A STUDY ON THE TRANSLATION OF DELIVERY TERMS IN INTERNATIONAL BUSINESS CONTRACTS Translation of some authentic international business contracts The general knowledge about terms ... knowledge in native language as well as foreign languages Finally, I am also interested in translation skill, especially in translation of terms and conditions in international business contracts ... of terms in international business contracts In details, my Graduation Paper aims at: A brief view of translation, an international business contract and delivery terms Techniques necessary for...
- 57
- 1,116
- 4
A study on translation of expression used in some vietnamese dishes into english
... Word-for-word translation 2.3 Literal translation 2.4 Faithful translation 2.5 Semantic translation 2.6 Adaptation translation 2.7 Idiomatic translation 2.8 Communicative translation 2.9 Other translations ... Modulation 5.6 Total syntagmatic changeAdaptation Chapter two: Translation of some popular Vietnamese dishes into English General introduction of popular Vietnamese dishes How to translate them into ... types of translation, some of the following types are sometime used during translation process They include: service translation, plum prose translation, information translation, cognitive translation, ...
- 61
- 676
- 1
A study on translation of related terms in industrial paint from english into vietnamese
... methods and equivalences in general and translation of ESP as well as technical translation in detail Chapter is an investigation on translation of related terms in Industrial paint from English into ... and ESP translation Chapter is an investigation on translation of terms related so Industrial paint from English into Vietnamese with the translation strategies Chapter is the implication of difficulties ... Types of ESP 21 III Industrial paint s ESP translation 23 Definition of technical translation 23 Translation in the area of industrial paint s terms 23 Terms in industrial...
- 57
- 501
- 0
A cross cultural study of addressing form in greetings in vietnamese and english
... burial of the dead; a gesture, such as a handshake or an idea, such as democracy Following this understanding, cultural trait may be an act, such as greeting And addressing forms in greetings also ... basic forms of address in English greetings 2.3 Addressing Forms in Greetings in Vietnamese and English 2.3.1 Addressing Forms 2.3.1.1 In Vietnamese In Vietnam, addressing forms is the meaningless ... of addressing forms in greetings in English and Vietnamese As shown from the study that social status plays a more important role in addressing in English meanwhile in Vietnam, age is the thing...
- 87
- 1,482
- 17
A cross cultural study of using hedges in refusing a request in english and vietnamese
... CHAPTER II ENGLISH AND VIETNAMESE IDIOMS USING NAMES OF ANIMALS 2.1 English and Vietnamese Idioms Using Names of Animals 2.1.1 The Names of Animals in English Idioms 2.1.2 The Names of Animals ... Pedagogical Suggestions for Teaching English Idioms Teaching and learning a language are teaching and learning a culture Language and culture can not be separated Teaching the idioms can be a ... and special features Using idioms in everyday enriches the color of language and abundance of life Both English and Vietnamese languages are rich in images and have a lot of idioms And among them,...
- 49
- 740
- 0
Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx
... occludin variant deleted in exon (OccDE9) On the basis of a comparative analysis of the involvement of wild-type occludin (OccWT) and variant occludin in apoptosis and invasion, as determined by assay, ... 5¢-CAGCAATTGTCACACATCAAGAA-3¢ (sense) and 5¢-T-ACATGTAGGTATGAAGACATCGTC T-3¢ (antisense) for exon 9; 5¢-TCCCTGCTTCCTCTGGC GGA-3¢ (sense) and 5¢-AGCCATAGCCATAGCCACTTC C-3¢ (antisense) for exon ... reverse transcriptase (Promega, Madison, WI, USA) For PCR of occludin variants, the primers used were: 5¢-ACTCGACAATGAACAATCCGTCAGAA-3¢ (sense) and 5¢-AGAGTATGCCATGGGACTGTCA-3¢ (antisense) for exon...
- 12
- 613
- 0
A study on polysemy of antonymous words in English Some related problems facing learners of English and suggested solutions
... cases of maintain, melt and take 2.1 Antonyms of maintain Maintain is a polysemantic word, because, it has related senses and one of sense has an antonym, which is analysed in the following examples ... these adverbs are antonymous adverbs (Outside and inside are adverbs and they are antonyms in terms of the contractory direction, carefully and carelessly are adverbs and they are antonyms in terms ... conversive antonyms and directional antonyms 1.2.1.1 Graded antonyms Graded antonyms are understood as antonyms which operate on a continuum, such often occur in binomial phrases with and: (blow) hot and...
- 65
- 726
- 0
Từ khóa: logic is defined as a science and art of correct thinkingother property plant and equipment and intangible assets such as a business or subsidiary of the acquirerclassification and ordination methods as a tool for analyzing of plant communities§ 19 benefit of mankind as a whole or benefit of humankind as a wholeheart muscle the heart as a pump and function of the heart valvesbudget essentials of budgeting types of budgets functional master etc fixed and flexible budget budgetary control zero base budgeting performance budgeting standard costing as a control technique setting of standards and their rdisplay 4 1 formal parameter used as a local variable 1 of 3display 4 1 formal parameter used as a local variable 2 of 3display 4 1 formal parameter used as a local variable 3 of 3franchising as a growth strategy10—how hebrew evolved as a modern vernacularfunction as a short term store of cysteineintracellular signaling network as a prime chemotherapy target of green tea catechin epigallocatechin 3 gallatecocaine as a local anesthetic mechanism of actiona miniaturized and portable µconductometer as a tool for detection of pesticidesNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ