0
  1. Trang chủ >
  2. Ngoại Ngữ >
  3. Kỹ năng đọc tiếng Anh >

1.3 Who should pay for higher educationquestions

Health Care for the Elderly - How Much? Who Will Pay For It pot

Health Care for the Elderly - How Much? Who Will Pay For It pot

... If so, the key question is not, “Shall we it? ” but rather, Who will pay? ” If expenditures continue to grow at the same rate as they have in the past, health care for the elderly in 2020 will require ... growth of health care spending on the elderly or find ways to pay for the additional care • SLOW THE GROWTH OF HEALTH CARE SPENDING Only three routes exist to slowing the growth of health care spending: ... to pay for future increases in health care Long-term reform of medicare (and Social Security) must face three harsh but inescapable facts First, total expenditures for health care of the elderly...
  • 5
  • 428
  • 0
Who Should Buy Long-Term Bonds? - INTERNATIONAL CENTER FOR FINANCIAL ASSET MANAGEMENT AND ENGINEERING pptx

Who Should Buy Long-Term Bonds? - INTERNATIONAL CENTER FOR FINANCIAL ASSET MANAGEMENT AND ENGINEERING pptx

... short-term risk This "myopic demand'' for long-term bonds can be large when risk aversion is small, because long-term bonds have attractive Sharpe ratios Second, long-term investors may hold long-term ... conventional wisdom, long-term bonds are appropriate for long-term investors who value stability of income We develop a model of optimal consumption and portfolio choice for infinitely-lived investors ... bonds for hedging purposes Long-term bonds can finance a stable longrun consumption stream even in the face of time-varying short-term interest rates, and this is attractive to risk-averse long-term...
  • 56
  • 458
  • 1
Báo cáo khoa học: NovelN,N¢-diacyl-1,3-diaminopropyl-2-carbamoyl bivalent cationic lipids for gene delivery – synthesis,in vitro transfection activity, and physicochemical characterization docx

Báo cáo khoa học: NovelN,N¢-diacyl-1,3-diaminopropyl-2-carbamoyl bivalent cationic lipids for gene delivery – synthesis,in vitro transfection activity, and physicochemical characterization docx

... (2004) Physicochemical optimisation of plasmid delivery by cationic lipids J Gene Med 6, S24 S35 15 Wasungu L & Hoekstra D (2006) Cationic lipids, lipoplexes and intracellular delivery of genes ... diameter around lm Use of DOPE and cholesterol to enhance the genedelivery properties of cationic lipids has been extensively documented [1621] For 1,3lb2 and 1,3lb3, transfection activity was appreciably ... cytofectins for gene delivery M Spelios and M Savva 18 Ferrari ME, Rusalov D, Enas J & Wheeler CJ (2002) Synergy between cationic lipid and co-lipid determines the macroscopic structure and transfection...
  • 15
  • 318
  • 0
Báo cáo khoa học: Novel b-1,3-, 1,6-oligoglucan elicitor from Alternaria alternata 102 for defense responses in tobacco docx

Báo cáo khoa học: Novel b-1,3-, 1,6-oligoglucan elicitor from Alternaria alternata 102 for defense responses in tobacco docx

... isolated from A alternata 102 Our previous work has indicated that the filtrate obtained from autoclaved A alternata 102 culture was able to induce marked chitinase activity in tobacco 2422 A alternata1 02 ... responses induced by AaGlucan in the intact tobacco plant seems similar to those induced by laminarin, which was reported to reduce pathogen infection [11], it Novel b-glucan elicitor from A alternata ... b-glucans During the course of a search for a potent elicitor of defense responses in a model plant cell (tobacco BY-2 cells), we found that the fungal strain Alternaria alternata 102 produces...
  • 11
  • 358
  • 0
Báo cáo Y học: ik3-1/Cables is a substrate for cyclin-dependent kinase 3 (cdk 3) pdf

Báo cáo Y học: ik3-1/Cables is a substrate for cyclin-dependent kinase 3 (cdk 3) pdf

... residue is also phosphorylated by both cdk3/cyclin A and cdk3/E in vivo (Fig 5) Analysis of ik3-1 amino-acid sequence indicates that ik3-1 has a putative ZRXL (Z and X are typically basic) motif that ... previously [11] To replace Ser274 in ik3-1 cDNA with Thr or Ala, mutagenic primers, 50 -TCTCCGGAGATGTCGAACACT CTCAGGTACTCCCAGACCA -30 or 50 -TCTCCGGAGAT GTCGAACACTCTCAGGTGCTCCCAGACCA -30 (corresponding ... that cyclin/ cdk3 actually phosphorylates ik3-1 P70ik3-1 is phosphorylated by either cyclin A/ cdk3 or cyclin E/cdk3 in vivo Furthermore, to examine whether p70ik3-1 is also phosphorylated by...
  • 7
  • 308
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " GaInNAs-based Hellish-vertical cavity semiconductor optical amplifier for 1.3 μm operation" potx

... JE: 1.3 m vertical -cavity amplifier IEEE Photonics Technol Lett 2000, 12:951 Bjorlin S, Abraham P, Pasquariello D, Piprek J, Chiu Yi-J, Bowers JE: High gain, high efficiency vertical -cavity semiconductor ... PL: photoluminescence; QWs: quantum wells; VCSEL: vertical cavity surface emitting laser; VCSOA: vertical cavity semiconductor optical amplifier Acknowledgements F.AI Chaqmaqchee is grateful to ... Bowers JE: Optical gain-bandwidth product of verticalcavity laser amplifiers Electron Lett 2001, 37:298 Karim A, Bjorlin S, Piprek J, Bowers JE: Long-wavelength vertical -cavity lasers and amplifiers...
  • 7
  • 238
  • 0
Giáo án tiếng anh lớp 5 - UNIT 9 ACTIVITIES FOR NEXT SUNDAY Section B (1-3) Period 45 doc

Giáo án tiếng anh lớp 5 - UNIT 9 ACTIVITIES FOR NEXT SUNDAY Section B (1-3) Period 45 doc

... Play game: Let’s talk F -Guide Ss to exercises 2.F T -Play game - < /b> Do exercises 8, in work book -T remarks the lesson -Learn by heart new words and structures -Prepare next < /b> lesson ... football? B: No I’m going to play volleyball (Yes, I am./No, I’m not) b Vocabulary: to take along(mang theo), cook lunch, next < /b> Sunday < /b> II TEACHING AIDS: Teacher’s: A cassette, puppets Students’: book, ... repeat a- Pre listen T says about the situation in the dialogue Look, Listen New words: next < /b> Sunday < /b> to take along -Guide Ss use questions: -Look, listen and repeat A: What are you going to next...
  • 6
  • 984
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Cap-independent protein translation is initially responsible for 4-(N-methylnitrosamino)-1-(3-pyridyl)-butanone (NNK)-induced apoptosis in normal human bronchial pithelial cells" pot

... capindependent protein translation was responsible for early apoptosis To understand the relative roles of cap-dependent and -independent protein translations in NNK-induced apoptosis in human bronchial ... transfection with bicistronic constructs To determine the status of cap-dependent and independent protein translation in NNK-induced apoptosis in human bronchial epithelial cells, we performed transient ... Rapamycin inhibits cap-dependent, but not cap-independent translation [2,17] In this study, we hypothesized that state of protein translation could play an important role in NNK-induced apoptosis...
  • 10
  • 155
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Molecular analysis of hprt mutation in B6C3F1 mice exposed to ozone alone and combined treatment of 4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone and/or dibutyl phthalate for 32 and 52 weeks" ppsx

... hypoxanthineguanine phosphoribosyltransferase (hprt) locus of lymphocytes isolated from spleens of mice following exposure to ozone, NNK, and DBP, and combined treatments of NNK and DBP on ozone for 32- ... Molecular analysis of hprt mutation 383 Table DNA sequence analysis of hprt mutant in splenic cells of B6C3F1 male mice in 52- wk study Type of mutation Number of mutants Control Ozone NNK DBP** Ozone+ NNK ... (Figs and 2) Analysis of hprt mutations in T-cells from spleens of control and test materials -exposed B6C3F1 mice Analysis of the spontaneous hprt mutant clones yielding The toxicologic actions of...
  • 7
  • 396
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "SemiWhole brain radiotherapy with a conformational external beam radiation boost for lung cancer patients with 1-3 brain metastasis: a multi institutional study" pdf

... presented with extra cranial failure/local brain failure/distant brain failure and extra cranial failure/distant brain failure, respectively Extra cranial failure and local brain failure only was observed ... metastases patients treated with accelerated-fractionation vs accelerated-hyperfractionated radiotherapy: an analysis from Radiation Therapy Oncology Group Study 91-04 International journal of radiation ... Y: Radiotherapy of brain metastases from carcinoma of the bronchus Clinical radiology 1989, 40:193-194 Page of 15 Egawa S, Tukiyama I, Akine Y, Kajiura Y, Yanagawa S, Watai K, Nomura K: Radiotherapy...
  • 8
  • 374
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Postmastectomy irradiation in breast in breast cancer patients with T1-2 and 1-3 positive axillary lymph nodes: Is there a role for radiation therapy" ppsx

... Cite this article as: Cosar et al.: Postmastectomy irradiation in breast in breast cancer patients with T1-2 and 1-3 positive axillary lymph nodes: Is there a role for radiation therapy? Radiation ... DMe Alive DM Death DM Death DM Death DM Death DM Alive Out-come a Lateral, bMedial, cInvasive ductal carcinoma, dInvasive Paget’s disease, eDistance metastasis patients had lung metastasis and ... is being examined in a randomized clinical trial” Many surgeons and radiation oncologist are not recommending PMRT to 1-3 axillary lymph node positive patients with a common understanding that...
  • 8
  • 357
  • 0
nvestigating the influences of tidal inundation and surface elevation on the establishment and early development of mangroves  for application in understanding mangrove rehabilitation techniques 1  3

nvestigating the influences of tidal inundation and surface elevation on the establishment and early development of mangroves for application in understanding mangrove rehabilitation techniques 1 3

... Surface elevations in mangroves, and its inherent control on periods of inundation and drainage, are therefore critical determinants of forest health For example, hyper- and hypo-salinity resulting ... periods, and hence surface elevations The general relationship between inundation durations and physiological functioning of mangroves is that prolonged inundation (from low surface elevations) impedes ... comprises of five inundation classes, with details on the frequency of 16 inundation per month and dominant mangrove species for each respective class For example, mangroves in Inundation Class will...
  • 16
  • 330
  • 0

Xem thêm

Từ khóa: why should taxpayers pay for birth controlwhy should taxpayers pay for abortionswhy should taxpayers pay for stadiumswho should write a letter of recommendation for medical schooljava api for xml processing jaxp 1 3microsoft net framework 3 5 offline installer for windows 8 1Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP