ỨNG DỤNG KỸ THUẬT PCR VÀ GIẢI TRÌNH TỰ GEN ĐỊNH DANH NẤM ĐƯỜNG SINH SẢN Ở PHỤ NỮ TRONG ĐỘ TUỔI SINH ĐẺ (18 - 49 TUỔI) ĐÃ CÓ CHỒNG TẠI THỊ XÃ QUẢNG YÊN TỈNH QUẢNG NINH (2013 - 2014)

ỨNG DỤNG KỸ THUẬT PCR GIẢI TRÌNH TỰ GEN ĐỊNH DANH NẤM ĐƯỜNG SINH SẢN PHỤ NỮ TRONG ĐỘ TUỔI SINH ĐẺ (18 - 49 TUỔI) ĐÃ CHỒNG TẠI THỊ QUẢNG YÊN TỈNH QUẢNG NINH (2013 - 2014)

ỨNG DỤNG KỸ THUẬT PCR VÀ GIẢI TRÌNH TỰ GEN ĐỊNH DANH NẤM ĐƯỜNG SINH SẢN Ở PHỤ NỮ TRONG ĐỘ TUỔI SINH ĐẺ (18 - 49 TUỔI) ĐÃ CÓ CHỒNG TẠI THỊ XÃ QUẢNG YÊN TỈNH QUẢNG NINH (2013 - 2014)
... GTGTTTTTCTTTGAAACAAACTTGCTTTGGCGGTCCCAGCCTGCCGCCAGAGGTCTAAACTTACAACCAATTTTTTA Calb-IST(5 Calb-IST(5 M1-H 1- 030 M 2- H 2-0 03 M-H 2- 052 M-H 2- 055 M-H 3-0 64 M-S-061 M-S-072 M-S-130 M-S-150 M-S-161 M-L-Đông-107 M-L-Hàn-074 M-L-Bầu-044 M-L- Đình-121 M-L-Quán-198 : : : : ... Cglab-ITS( Cglab-ITS( M3-H 1-0 52 M4-H 1-0 53 M8-H 2-0 08 M9-H 2-0 19 M15-H 2-0 62 M20-H 3-0 70 M1-H 3-0 16 M6-H 3-0 42 M7-H 3-0 46 M16-H 3-0 69 M18-H 3-0 73 M21-H 3-0 82 M22-H 3-0 83 M2-S-007 M8-S-082 M10-S-096 M15-S-122 ... Cglab-ITS( Cglab-ITS( M3-H 1-0 52 M4-H 1-0 53 M8-H 2-0 08 M9-H 2-0 19 M15-H 2-0 62 M20-H 3-0 70 M1-H 3-0 16 M6-H 3-0 42 M7-H 3-0 46 M16-H 3-0 69 M18-H 3-0 73 M21-H 3-0 82 M22-H 3-0 83 M2-S-007 M8-S-082 M10-S-096 M15-S-122...
  • 11
  • 31
  • 0

Phát hiện đột biến gen COL1A1 trên bệnh nhân tạo xương bất toàn bằng kỹ thuật PCR giải trình tự gen

Phát hiện đột biến gen COL1A1 trên bệnh nhân tạo xương bất toàn bằng kỹ thuật PCR và giải trình tự gen
... bệnh tạo xương bất toàn thực nhằm mục tiêu: Phát đột biến gen COL1A1 bệnh nhân tạo xương bất toàn kỹ thuật PCR giải trình tự gen 8 CHƯƠNG I TỔNG QUAN 1.1 Lịch sử phát tình hình nghiên cứu bệnh ... 1.4 Các kỹ thuật sinh học phân tử phát đột biến gen COL1A1 Các đột biến gen COL1A1 chủ yếu đột biến điểm kỹ thuật PCR giải trình tự trực tiếp sử dụng để phát đột biến Trong trường hợp đột biến nằm ... collagen týp I (da, xương) Như để phát đột biến gen COL1A1 cần ý tới kỹ thuật là: PCR, RT -PCR giải trình tự gen 1.4.1 Kỹ thuật Polymerase Chain Reaction (PCR) : PCR kỹ thuật nhân DNA ống nghiệm...
  • 68
  • 124
  • 0

Nghiên cứu thực trạng nhiễm sinh trùng đường sinh sản phụ nữ độ tuổi 18 49 đã chồng tại thị Quảng Yên tỉnh Quảng Ninh hiệu quả điều trị

Nghiên cứu thực trạng nhiễm ký sinh trùng đường sinh sản ở phụ nữ độ tuổi 18  49 đã có chồng tại thị xã Quảng Yên tỉnh Quảng Ninh và hiệu quả điều trị
... LUẬN VÀ KHUYẾN NGHỊ KẾT LUẬN 1.1 Thực trạng nhiễm trùng nấm, đơn bào ĐSS phụ nữ độ tuổi sinh đẻ 18 - 49 chồng thị Quảng Yên, tỉnh Quảng Ninh năm 2013: - Tỷ lệ phụ nữ nghiên cứu mắc bệnh nhiễm ... gian nghiên cứu 2.1.1 Đối tượng nghiên cứu Phụ nữ độ tuổi 18 - 49, chồng, sinh sống thị Quảng Yên - Tiêu chuẩn chọn mẫu: Tự nguyên thạm gia nghiên cứu, thường trú địa phương từ 12 tháng trở ... Hoàng Tân thuộc thị Quảng Yên, tỉnh Quảng Ninh 2.1.2.2 Nghiên cứu phòng thí nghiệm - Kỹ thuật nuôi cấy nấm thực phòng xét nghiệm thuộc Trung tâm Y tế Quảng Yên, tỉnh Quảng Ninh 7 - Kỹ thuật...
  • 24
  • 116
  • 1

Luận án tiến sĩ Nghiên cứu thực trạng nhiễm sinh trùng đường sinh sản phụ nữ độ tuổi 18 - 49 đã chồng tại thị Quảng Yên tỉnh Quảng Ninh hiệu quả điều trị

Luận án tiến sĩ Nghiên cứu thực trạng nhiễm ký sinh trùng đường sinh sản ở phụ nữ độ tuổi 18 - 49 đã có chồng tại thị xã Quảng Yên tỉnh Quảng Ninh và hiệu quả điều trị
... độ thực hành phụ nữ địa bàn nghiên cứu phòng chống bệnh NTĐSS 23 KẾT LUẬN VÀ KHUYẾN NGHỊ KẾT LUẬN 1.1 Thực trạng nhiễm trùng nấm, đơn bào ĐSS phụ nữ độ tuổi sinh đẻ 18 - 49 chồng thị Quảng ... gian nghiên cứu 2.1.1 Đối tượng nghiên cứu Phụ nữ độ tuổi 18 - 49, chồng, sinh sống thị Quảng Yên - Tiêu chuẩn chọn mẫu: Tự nguyên thạm gia nghiên cứu, thường trú địa phương từ 12 tháng trở ... Quảng Yên, tỉnh Quảng Ninh năm 2013: - Tỷ lệ phụ nữ nghiên cứu mắc bệnh nhiễm trùng đường sinh sản 48,5%, viêm cổ tử cung đơn chiếm tỷ lệ cao 50,6% - Tỷ lệ nhiễm trùng đường sinh sản phụ nữ Candida...
  • 24
  • 193
  • 0

PHÂN LẬP ĐỊNH DANH TÁC NHÂN GÂY BỆNH ĐỐM LÁ CÂY CẢI NGỌT TẠI TP. HCM BẰNG KỸ THUẬT PCR GIẢI TRÌNH TỰ VÙNG 16S – 23S rDNA docx

PHÂN LẬP VÀ ĐỊNH DANH TÁC NHÂN GÂY BỆNH ĐỐM LÁ CÂY CẢI NGỌT TẠI TP. HCM BẰNG KỸ THUẬT PCR VÀ GIẢI TRÌNH TỰ VÙNG 16S – 23S rDNA docx
... DỤC VÀ ĐÀO TẠO TRƢỜNG ĐẠI HỌC NÔNG LÂM TP HCM BỘ MÔN CÔNG NGHỆ SINH HỌC ***000*** PHÂN LẬP VÀ ĐỊNH DANH TÁC NHÂN GÂY BỆNH ĐỐM LÁ CÂY CẢI NGỌT TẠI TP HCM BẰNG KỸ THUẬT PCR VÀ GIẢI TRÌNH TỰ VÙNG 16S ... chọn thực đề tài: Phân lập định danh tác nhân gây bệnh đốm cải Tp HCM phƣơng pháp PCR giải trình tự vùng 16S 23S rDNA Đề tài phần chƣơng trình nghiên cứu bệnh vi khuẩn họ thập tự Bộ môn Bảo Vệ ... + (+) + ND + V + V + + V– V+ + V + V– V V Begoniae V V+ + Manihotis V + V malvacearum (+) oryzae V pelamgonii vesicatoria + + V– V + + V V– V pruni + (+) + V...
  • 52
  • 215
  • 1

Luận văn : PHÂN LẬP ĐỊNH DANH TÁC NHÂN GÂY BỆNH ĐỐM LÁ CÂY CẢI NGỌT TẠI TP. HCM BẰNG KỸ THUẬT PCR GIẢI TRÌNH TỰ VÙNG 16S – 23S rDNA part 3 pdf

Luận văn : PHÂN LẬP VÀ ĐỊNH DANH TÁC NHÂN GÂY BỆNH ĐỐM LÁ CÂY CẢI NGỌT TẠI TP. HCM BẰNG KỸ THUẬT PCR VÀ GIẢI TRÌNH TỰ VÙNG 16S – 23S rDNA part 3 pdf
... đại vùng 16S 23S rDNA 1: CC1, 2: CC2, 3: CC3, 4: Ladder 1,5kb, 5: HM1, 6: HM2, 7: Q12-1, 8: DC Sản phẩm PCR đƣợc tinh đọc trình tự Trình tự DNA có đƣợc so sánh với liệu ngân hàng gen để định danh ... kết luận định danh dòng vi khuẩn 33 kb 535 bp Hình 4.10 Kết khuếch đại đoạn DNA vùng hrpF 1: HM1, 2: HM2, 3: CC1, 4: Ladder 1kb, 5: CC2, 6: Q12 1, 7: DC Chƣơng KẾT LUẬN VÀ ĐỀ NGHỊ 5.1 Kết luận ... Kết thúc đề tài, thiết lập đƣợc quy trình phân lập định danh vi khuẩn gây bệnh đốm cải Tp HCM Quy trình đƣợc thực nhƣ sau: Thu thập mẫu bệnh vùng trồng rau trọng điểm Tp HCM: Tiến hành khảo sát...
  • 16
  • 191
  • 0

Luận văn : PHÂN LẬP ĐỊNH DANH TÁC NHÂN GÂY BỆNH ĐỐM LÁ CÂY CẢI NGỌT TẠI TP. HCM BẰNG KỸ THUẬT PCR GIẢI TRÌNH TỰ VÙNG 16S – 23S rDNA part 2 doc

Luận văn : PHÂN LẬP VÀ ĐỊNH DANH TÁC NHÂN GÂY BỆNH ĐỐM LÁ CÂY CẢI NGỌT TẠI TP. HCM BẰNG KỸ THUẬT PCR VÀ GIẢI TRÌNH TỰ VÙNG 16S – 23S rDNA part 2 doc
... + (+) + ND + V + V + + V– V+ + V + V– V V Begoniae V V+ + Manihotis V + V malvacearum (+) oryzae V pelamgonii vesicatoria + + V– V + + V V– V pruni + (+) + V ... dùng kỹ thuật PCR sử dụng cặp primer Xan 1330 5’ GTT CCC GGG CCT TGT ACA CAC 3’ Xan 322 5’ GGT TCT TTT CAC CTT TCC CTC 3’ thiết kế dựa vùng rDNA 16S 23 S để khuếch đại vùng 16S 23 S rDNA ... (+) + V + + + V– + V– + + V– (+) V– V+ V– + phaseoli + carotae + Translucens campestris 2. 1.7 Những nghiên cứu phát dịnh danh tác nhân gây bệnh phƣơng pháp sinh học phân tử Để đánh...
  • 18
  • 133
  • 0

Luận văn : PHÂN LẬP ĐỊNH DANH TÁC NHÂN GÂY BỆNH ĐỐM LÁ CÂY CẢI NGỌT TẠI TP. HCM BẰNG KỸ THUẬT PCR GIẢI TRÌNH TỰ VÙNG 16S – 23S rDNA part 1 ppt

Luận văn : PHÂN LẬP VÀ ĐỊNH DANH TÁC NHÂN GÂY BỆNH ĐỐM LÁ CÂY CẢI NGỌT TẠI TP. HCM BẰNG KỸ THUẬT PCR VÀ GIẢI TRÌNH TỰ VÙNG 16S – 23S rDNA part 1 ppt
... DỤC VÀ ĐÀO TẠO TRƢỜNG ĐẠI HỌC NÔNG LÂM TP HCM BỘ MÔN CÔNG NGHỆ SINH HỌC ***000*** PHÂN LẬP VÀ ĐỊNH DANH TÁC NHÂN GÂY BỆNH ĐỐM LÁ CÂY CẢI NGỌT TẠI TP HCM BẰNG KỸ THUẬT PCR VÀ GIẢI TRÌNH TỰ VÙNG 16 S ... chọn thực đề tài: Phân lập định danh tác nhân gây bệnh đốm cải Tp HCM phƣơng pháp PCR giải trình tự vùng 16 S 23S rDNA Đề tài phần chƣơng trình nghiên cứu bệnh vi khuẩn họ thập tự Bộ môn Bảo ... Dùng kỹ thuật PCR giải trình tự gen nhằm định danh tác nhân gây bệnh Kết thu đƣợc nhƣ sau: Phân lập đƣợc dòng vi khuẩn gây bệnh đốm vùng trồng rau thuộc huyện Củ Chi, Hóc Môn quận 12 , Tp HCM Sử...
  • 18
  • 108
  • 0

Ứng dụng kỹ thuật PCR lây nhiễm nhân tạo kiểm chứng gen kháng bệnh bạc lá các dòng đẳng gen

Ứng dụng kỹ thuật PCR và lây nhiễm nhân tạo kiểm chứng gen kháng bệnh bạc lá ở các dòng đẳng gen
... không xác Chính vì vậy chúng em tiến hành đề tài Ứng dụng kỹ thuật PCR lây nhiễm nhân tạo kiểm chứng gen kháng bệnh bạc dòng đẳng gen Phan Thị Hương, Nguyễn Thị Vân Anh, Bùi Văn Công, ... vấn đề  Dòng đẳng gen dòng gen giống khác gen kháng Dòng đẳng gen đóng vai trò quan trọng việc xác định thành phần chủng bệnh bạc Việc kết luận xác thành phần chủng bệnh bạc và gen nào ... PGS.TS Phan Hữu Tôn cộng sự, xác định phổ kháng nhiễm gen chủng vi khuẩn Miền Bắc Việt Nam, dựa vào phát có mặt gen dòng đẳng gen phương pháp lây nhiễm nhân tạo Phan Thị Hương, Nguyễn Thị Vân...
  • 32
  • 420
  • 2

ứng dụng kỹ thuật pcr rt-pcr trong chẩn đoán wssv (white spot syndrome virus) gav (gill-associated virus) trên tôm sú (penaeus monodon) đồng bằng sông cửu long

ứng dụng kỹ thuật pcr và rt-pcr trong chẩn đoán wssv (white spot syndrome virus) và gav (gill-associated virus) trên tôm sú (penaeus monodon) ở đồng bằng sông cửu long
... tài Ứng dụng kỹ thuật PCR RT -PCR chẩn đoán WSSV (White Spot Syndrome Virus) GAV (Gill associated virus) tôm (Penaeus monodon) đồng sông Cửu Long thực Mục tiêu đề tài Xác định khả ứng dụng ... nhằm xác định khả ứng dụng phương pháp RTPCR PCR nghiên cứu tác nhân GAV WSSV tôm giống số tỉnh Đồng Bằng Sông Cửu Long Trong 169 mẫu tôm giống phân tích kit IQ2000 YHV /GAV WSSV có 10,7% mẫu ... khả ứng dụng qui trình RT -PCR PCR chẩn đoán phát sớm vi-rút GAV, WSSV tôm (Penaeus monodon) đồng sông Cửu Long Nội dung đề tài Xác định tỉ lệ cảm nhiễm tự nhiên GAV WSSV tôm giống xét nghiệm...
  • 74
  • 417
  • 0

LUẬN VĂN TỐT NGHIỆP: " ỨNG DỤNG KỸ THUẬT PCR RT-PCR TRONG CHẨN ĐOÁN WSSV (White Spot Syndrome virus) GAV (Gill-associated virus) TRÊN TÔM SÚ (Penaeus monodon) ĐỒNG BẰNG SÔNG CỬU LONG" docx

LUẬN VĂN TỐT NGHIỆP:
... tài Ứng dụng kỹ thuật PCR RT -PCR chẩn đoán WSSV (White Spot Syndrome Virus) GAV (Gill associated virus) tôm (Penaeus monodon) đồng sông Cửu Long” thực Mục tiêu đề tài Xác định khả ứng dụng ... nhằm xác định khả ứng dụng phương pháp RTPCR PCR nghiên cứu tác nhân GAV WSSV tôm giống số tỉnh Đồng Bằng Sông Cửu Long Trong 169 mẫu tôm giống phân tích kit IQ2000 YHV /GAV WSSV có 10,7% mẫu ... khả ứng dụng qui trình RT -PCR PCR chẩn đoán phát sớm vi-rút GAV, WSSV tôm (Penaeus monodon) đồng sông Cửu Long Nội dung đề tài Xác định tỉ lệ cảm nhiễm tự nhiên GAV WSSV tôm giống xét nghiệm...
  • 74
  • 341
  • 1

ứng dụng kỹ thuật PCR FISH nghiên cứu biến đổi ADN một số thể bệnh lơxêmi hemophilia a

ứng dụng kỹ thuật PCR và FISH nghiên cứu biến đổi ADN ở một số thể bệnh lơxêmi và hemophilia a
... liờn quan 2.2.1 Nghiên cứu nớc 2.2.2 Nghiên cứu nớc Đối tợng phơng pháp nghiên cứu 3.1 Đối tợng nghiên cứu 3.1.1 Ngời tình nguyện 3.1.2 Thuốc nghiên cứu 3.2 Vật liệu phơng tiện nghiên cứu 3.2.1 ... theophylin tác dụng kéo dài cấu tạo cốt (matrix), cấu tạo pellet "bồi dần" với viên Theostat hãng Anova, Euphylin Laboratoires BYK LA , viên Nifedipin cấu tạo cốt với viên Adalat retard hãng Bayer [11], ... phẩm metformin nghiên cứu Các thuốc sử dụng nghiên cứu chế phẩm mới, thuốc sử dụng điều trị cho bệnh nhân Các lô thuốc hai chế phẩm a vào nghiên cứu có phiếu kiểm nghiệm cho thấy hai chế phẩm đạt...
  • 70
  • 155
  • 0

Ứng dụng kỹ thuật PCR FISH nghiên cứu biến đổi ADN một số thể bệnh lơ xê mi hemophilia a

Ứng dụng kỹ thuật PCR và FISH nghiên cứu biến đổi ADN ở một số thể bệnh lơ xê mi và hemophilia a
... Bộ y tế Báo cáo kết nghiên cứu đề tài cấp ứng dụng kỹ thuật PCR fish nghiên cứu biến đổi adn số thể bệnh mi hemophilia A Chủ nhiệm đề tài : PGS TS Phạm Quang vinh Cơ quan chủ trì đề tài : ... ngời mang gen Hemophilia A - ứng dụng đợc kỹ thuật PCR kỹ thuật FISH để xác định gen hỗn hợp ABL/BCR mi kinh dòng tủy ứng dụng kỹ thuật RT PCR phát gen AML/ETO RAR/PML mi cấp dòng ... Báo cáo kết nghiên cứu đề tài cấp Tên đề tài: ứng dụng kỹ thuật PCR FISH nghiên cứu biến đổi ADN số thể bệnh mi Hemophilia A : PGS TS Phạm Quang vinh Chủ nhiệm đề tài Cơ quan chủ trì đề tài...
  • 91
  • 170
  • 0

Ứng dụng kỹ thuật PCR phát hiện nhanh tụ cầu vàng staphylococcus aureus

Ứng dụng kỹ thuật PCR phát hiện nhanh tụ cầu vàng staphylococcus aureus
... phản ứng PCR phát nhanh Staphylococcus aureus - Xây dựng qui trình tách chiết DNA phù hợp cho phát nhanh Staphylococcus aureus kỹ thuật PCR - Xác định điều kiện tối ưu phản ứng PCR phát nhanh Staphylococcus ... cặp mồi cho phản ứng PCR 14 3.4.3 Xây dựng qui trình phát nhanh Staphylococcus aureus kỹ thuật PCR 14 3.4.5 Xác định giới hạn phát phản ứng PCR phát nhanh Staphylococcus aureus ... ứng dụng: + 01 cặp mồi đặc hiệu cho phản ứng PCR phát nhanh vi khuẩn tụ cầu vàng Staphylococcus aureus + 01 Quy trình phát nhanh tụ cầu vàng Staphylococcus aureus mức độ chủng phòng thí nghiệm SUMMARY...
  • 34
  • 56
  • 0

Xem thêm

Từ khóa: ba lời thoại lãng mạn nhất màn ảnhquảng cáo bằng lời nóibài ca ngắn đi trên bãi cát cao bá quátbài tập java nâng cao có lời giảibài tập đạo hàm cấp cao có lời giảibài tập toán lớp 6 nâng cao có lời giảisở giao thông vận tải hà nội cao bá quátsở giao thông vận tải hà nội 16 cao bá quáttuyển tập thơ cao bá quáttoán lớp 4 nâng cao có lời giảibài tập toán lớp 11 nâng cao có lời giảibài tập hóa học 11 nâng cao có lời giảibài tập pascal nâng cao có lời giảibài tập toán lớp 10 nâng cao có lời giảibài tập excel 2007 nâng cao có lời giảiDấu ngạch ngang LTVC lớp 4 số 5Dấu ngạch ngang LTVC lớp 4 số 6Tap doc tuan 11 ÔNG TRẠNG THẢ DIỀUTẬP đọc kéo cóTHẾ nào là kể CHUYỆNDấu ngạch ngang LTVC lớp 4 số 7NGUYÊN NHÂN làm nước bị ô NHIỄMMỘT NHÀ THƠ CHÂN CHÍNHPHÂN TÍCH hợp ĐỒNG XUẤT KHẨU CÔNG TY NGUYỆT MINH 2KHÁT VỌNG SỐNGPHÂN TÍCH hợp ĐỒNG XUẤT KHẨU CÔNG TY NGUYỆT MINH 2PHÂN TÍCH hợp ĐỒNG NHẬP KHẨU THÉP của tập đoàn HOA SENLUYỆN tập xây DỰNG kết bài TRONG văn MIÊU tả đồ vậtDấu ngạch ngang LTVC lớp 4 số 11Dấu ngạch ngang LTVC lớp 4 số 14HOẠT ĐỘNG NÔNG NGHIỆPGiao tiếp với khách hàngDấu ngạch ngang LTVC lớp 4 số 18Câu kể ai là gì LTVC lớp 4 số 5ĐƯỜNG đi SA PA
Nạp tiền Tải lên
Đăng ký
Đăng nhập