Analysis of primary presidential preference votes in 5 states shows problems in the absentee ballots

Báo cáo khoa học: Analysis of Lsm1p and Lsm8p domains in the cellular localization of Lsm complexes in budding yeast ppt

Báo cáo khoa học: Analysis of Lsm1p and Lsm8p domains in the cellular localization of Lsm complexes in budding yeast ppt
... analysis of Lsm1 p showing the importance of residues proposed to be involved in RNA binding and complex formation, and of the C-terminal region for the func- Lsm1 and -8 domains involved in localization ... N- and ⁄ or C-terminal domains, exchanged the central Sm domains or, in the case of Lsm8 p, made point mutations in putative RNA-binding residues We investigated the cellular localization of GFPtagged ... in 5–20% of cells under stress conditions (Fig 5B), suggesting that the N-terminal domain of Lsm1 p is sufficient in combination with the Sm and C-terminal domains of Lsm8 p (i.e presumably in the...
  • 16
  • 172
  • 0

An Analysis of Business Administration Students Interest in the area of production and Operations pot

An Analysis of Business Administration Students Interest in the area of production and Operations pot
... Lima, Dorelland P and Andrade, Raphael J C.: An Analysis os Business Administration Students Interest in the Area of Production and Operations Journal of Operations and Supply Chain Management ... Costa, Francisco J., Lima, Dorelland P and Andrade, Raphael J C.: An Analysis os Business Administration Students Interest in the Area of Production and Operations 90 Journal of Operations and Supply ... Costa, Francisco J., Lima, Dorelland P and Andrade, Raphael J C.: An Analysis os Business Administration Students Interest in the Area of Production and Operations 96 Journal of Operations and Supply...
  • 13
  • 111
  • 0

báo cáo hóa học:" Microarray analysis of Foxl2 mediated gene regulation in the mouse ovary derived KK1 granulosa cell line: Over-expression of Foxl2 leads to activation of the gonadotropin releasing hormone receptor gene promoter" pptx

báo cáo hóa học:
... al.: Microarray analysis of Foxl2 mediated gene regulation in the mouse ovary derived KK1 granulosa cell line: Over-expression of Foxl2 leads to activation of the gonadotropin releasing hormone receptor ... resulted in finding a total of 42 genes common to both (Additional file 10) In order to begin to understand the significance of the genes common to the three microarray studies in the ovary, we then ... the prolactin receptor which is localized to granulosa cells as well as other cell types in the rat ovary [46] Prolactin receptor expression in rat granulosa cells is increased by treatment of...
  • 12
  • 121
  • 0

Báo cáo y học: "Analysis of immunoglobulin light chain rearrangements in the salivary gland and blood of a patient with Sjögren’s syndrome" pptx

Báo cáo y học:
... daily at the time of analysis After developing parotid gland enlargement, lymphoma of the parotid gland was excluded by partial parotidectomy and histological examination After approval by the ... typically present in sera of patients with SS [18] and was also detected in the saliva or in salivary gland biopsies [19] of these patients In this regard, Martin et al described two salivary ... is inline with the assumption that plasma and memory B cells accumulate in the parotid gland but cannot clarify the origin of these cells Whatever the primary aberration in the induction of the...
  • 12
  • 153
  • 0

báo cáo khoa học: "Transcriptional analysis of cell growth and morphogenesis in the unicellular green alga Micrasterias (Streptophyta), with emphasis on the role of expansin" pot

báo cáo khoa học:
... participated in the synchronization and RNA-extraction and in the interpretation of the data JG and LDV participated in the design of the experiments DI and WV conceived and supervised the study ... Vannerum et al.: Transcriptional analysis of cell growth and morphogenesis in the unicellular green alga Micrasterias (Streptophyta), with emphasis on the role of expansin BMC Plant Biology 2011 ... of the evolution of genes involved in cell wall formation in green algae and land plants Cell walls have played crucial roles in the colonization of land by plants [63,64]...
  • 17
  • 145
  • 0

Báo cáo y học: " Molecular analysis of HBV genotypes and subgenotypes in the Central-East region of Tunisia" potx

Báo cáo y học:
... al.: Molecular analysis of HBV genotypes and subgenotypes in the Central-East region of Tunisia Virology Journal 2010 7:302 Submit your next manuscript to BioMed Central and take full advantage of: ... NH and OB conceived of the study, participated in its design, and in drafting the manuscript HT and JB participated in the study design and coordination and in discussing manuscript NH, NBF and ... suggested the predominance of this new subgenotype in the region [23,28] Subgenotype D1 is Page of predominant in the Eastern part of Africa; Saudy et al described it in Egypt [29] Our region geographically...
  • 6
  • 82
  • 0

Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot

Báo cáo y học:
... member KLRD1L gtgggagaatggctctgc KLRD1R tttgtattaaaagtttcaaatgatgga BDLvsLTNP CD8 2.5 2.1 IRS2 NM_003749.2 insulin receptor substrate IRS2L tgacttcttgtcccaccactt IRS2R catcctggtgataaagccaga CD8 3.8 ... ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt BDLvsVIR CD8 -1.3 -2.2 ATP6V1D NM_015994.2 ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6V1DR ... cycle and OXPHOS pathways along with a series of degradation pathways of carbohydrates, fatty acids, and amino acids, articulating with the TCA cycle by furnishing substrates Interestingly, this...
  • 21
  • 75
  • 0

Báo cáo y học: " Analysis of repetitive DNA distribution patterns in the Tribolium castaneum genome" pptx

Báo cáo y học:
... comparisons, analysis of these regions indicates a noticeable reduction in the rate of recombination in regions containing a high density of repetitive DNA, supporting our hypothesis that these regions ... Density distribution of repetitive DNA on each chromosome of T castaneum Density and distribution of repetitive DNA on each chromosome of T castaneum The total length (kb) of repetitive DNA in each ... if the regions accumulating repetitive DNA are derived from heterochromatin, then they might contain fewer genes than the repetitive DNA- poor intervals To test this hypothesis, the density of...
  • 14
  • 132
  • 0

Analysis of p13k independent survival pathways in the prostate cancer cell line LN cap 1

Analysis of p13k independent survival pathways in the prostate cancer cell line LN cap 1
... Role of Superoxide anion in Cancer 55 PROSTATE CANCER 1. 6 .1 1.6.2 1. 6.3 AIM OF STUDY MATERIALS 2 .1. 1 2 .1. 2 2 .1. 3 2 .1. 4 2.2 GROWTH-FACTOR REGULATION OF CELL SURVIVAL 3 .1. 1 3 .1. 2 3 .1. 3 3 .1. 4 3 .1. 5 ... Bad-dependent 11 6 RSK1 is the Bad kinase activated by EGF in LNCaP cells 12 1 iv 3 .1. 8 3 .1. 9 3 .1. 10 3.2 Role of ErbB receptors in EGF- and serum-mediated survival of LNCaP cells 13 0 Bax ... apoptosis in LNCaP cells 13 8 Serum promotes cell survival in LY-treated LNCaP cells via inhibition of Bad and Bax translocation .14 1 REACTIVE OXYGEN SPECIES REGULATION OF CELL SURVIVAL 3.2 .1 3.2.2...
  • 140
  • 60
  • 0

Analysis of p13k independent survival pathways in the prostate cancer cell line LN cap 2

Analysis of p13k independent survival pathways in the prostate cancer cell line LN cap 2
... SERUM-MEDIATED SURVIVAL IS INDEPENDENT OF MEKERK- AND PI3K-AKT -INDEPENDENT PATHWAY IN LNCAP CELLS Although both EGF and serum inhibited LY-induced apoptosis in LNCaP cells, analysis of survival signaling involved ... PI3K-AKT -INDEPENDENT SURVIVAL PATHWAY(S) IN LNCAP CELLS The PI3K-Akt pathway has been proposed to be the major survival pathway in LNCaP cells due to PTEN inactivation in this PCa cell line (Lin et ... supporting the essential role of O2·− in regulation of LNCaP cells sensitivity to apoptosis by LY This is in line with other recent findings that have demonstrated that an increase in intracellular...
  • 117
  • 49
  • 0

Molecular analysis of maternal diabetes induced changes in the developing neural tube

Molecular analysis of maternal diabetes induced changes in the developing neural tube
... in e A III LV E B dc dc e vtw vtw E C vt dt D Fig Thickness of Ventral Telencephalon Wall (µm) 300 250 * 200 150 100 50 Fig Control Diabetic vt dt vt vt A B Fig % of BrdU-cells in Ventral ... vt B e A Fold of induction 3.5 ** 2.5 1.5 0.5 Control Diabetic B 333bp C Fig dc dc III vt A vt B LV A Fig dc e dc III vt vt LV A Fig dt B III e e e dc vt LV A Fig 10 B A Fold of induction 1.5 ... TGF-ß l TGF-ß l III III E F TNF-α III G Fig 17 TNF-α G III H Lectin TGF-ß1 A B C Lectin TNF-α III D Fig 18 TGF-ß1+Lectin TNF-α+Lectin III III E F tm III htms III htm A Fig 19 B 50 Mean Cell numbers/mm...
  • 19
  • 34
  • 0

Contrative analysis of primary sentences in english and those in vietnamese

Contrative analysis of primary sentences in english and those in vietnamese
... scope of using primary imperative sentences in English and that in Vietnamese; To suggest some practical applications about primary imperative sentences in English and those in Vietnamese Scope of ... Contrastive analysis of primary imperative sentences in English and those in Vietnamese Structure of the primary imperative sentences According to Brown and Levinson (1978) about the structure of primary ... đừng giận anh Scope of using primary imperatives in English and that in Vietnamese 34 In daily life To identify the scope of using primary imperatives in English and that in Vietnamese, it is noteworthy...
  • 51
  • 213
  • 1

Báo cáo y học: " Maintenance of response with atypical antipsychotics in the treatment of schizophrenia: a post-hoc analysis of 5 double-blind, randomized clinical trials" ppsx

Báo cáo y học:
... quetiapine, and aripiprazole groups Discussion In this post-hoc analysis of randomized, double-blind trials of olanzapine versus other atypical antipsychotics, patients treated with olanzapine ... H, Taylor CC, Dunayevich E, Davis JM: All-cause treatment discontinuation in schizophrenia during treatment with olanzapine relative to other antipsychotics: an integrated analysis J Clin Psychopharmacol ... patient vulnerabilities Conclusion In this study, we have provided data on how treatment with olanzapine compares to treatment with other antipsychotics in maintaining treatment response Maintenance...
  • 12
  • 120
  • 0

Investigation and application of liquid chromatography mass spectrometry in the analysis of polar, less volatile and thermal unstable organic pollutants in environmental and biological samples 5

Investigation and application of liquid chromatography mass spectrometry in the analysis of polar, less volatile and thermal unstable organic pollutants in environmental and biological samples 5
... freedom for the assignment of the variables under consideration The assignment of the main variables (A, B, C and D), two-variable interaction, and the level setting values of the main variables ... optimization of the MAE conditions To apply these techniques in practical applications, in this chapter I 138 demonstrated the application of these techniques in analysis of the residues of Nmethylcarbamate ... the average recovery (AR) results that the combination of A1 and B2 would result in a maximum response Since effects of duration time and volume of the solvents (factors C and D) are minor, less...
  • 22
  • 38
  • 0


... of Water and Environment Technology, Vol.2, No.2, 2004 Therefore, we investigated successional development of nitrifying bacterial community structure and in situ nitrifying activities in biofilms ... distributions of in situ nitrifying activities were determined The relationship between the spatial organization of nitrifying bacterial populations and the in situ activity of these populations within ... diversity of ammonia-oxidizing bacteria The phylogenetic microbial diversity of two types of nitrifying biofilms, a domestic wastewater and an autotrophic nitrifying biofilms, were determined by...
  • 10
  • 235
  • 0

Xem thêm

Từ khóa: Các dạng thù hình carbon và carbon hoạt tính2 thpt tran hung dao tphcm nam 2017 lan 1 co loi giai10 thpt han thuyen bac ninh nam 2017 lan 1 co loi giaiCực trị hàm số Trắc nghiệm Toán 2017 Thầy Trần Tài13 so gddt vinh phuc nam 2017 lan 1 co loi giaithpt chuyen bac can bac can nam 2017 lan 1 co loi giai16 thpt luong tai so 2 bac ninh nam 2017 lan 1 co loi giaiVăn hóa, tôn giáo, tín ngưỡng Việt Nam Léopold CadièreThe Anatomy Coloring Book, 4th EditionThế Lực Khách Trú Và Vấn Đề Di Dân Vào Nam KỳSlide bài giảng Tư tưởng Hồ Chí Minh Chương 1Slide bài giảng Tư tưởng Hồ Chí Minh Chương 4Slide bài giảng Tư tưởng Hồ Chí Minh Chương 7Slide bài giảng Tư tưởng Hồ Chí Minh Chương 5Slide bài giảng Tư tưởng Hồ Chí Minh Chương mở đầuStrategic management planing for domestic and global competition 14th john robinson chapter 14Strategic management planing for domestic and global cometition 14th john robinson chapter 5Strategic management planing for domestic and global competition 14th john robinson chapter 6TUYỆT ĐỈNH LUYỆN đề THI THPT QUỐC GIA môn hóa học tập 2 p2Nghiên cứu ứng xử của sỹ quan hàng hải việt nam trong tình huống cắt hướng có nguy cơ đâm va trên biển trong điều kiện nhìn thấy nhau bằng mắt thường tại phòng mô phỏng hàng hải thuộc trường đại học hàng hải việt nam
Nạp tiền Tải lên
Đăng ký
Đăng nhập