0
  1. Trang chủ >
  2. Ngoại Ngữ >
  3. Kỹ năng viết tiếng Anh >

Topic requirements and effects

Topic requirements and effects

Topic requirements and effects

... would help to improve the economic situation and would render the city a more important center for the region Yet, this might also have certain negative effects on the community Older people, being ... traffic, the abuse of alcohol or violence and crime To sum up, it seems important to me to consider which type of university could profit form the local environment and to ensure that important factors...
  • 2
  • 423
  • 0
The Treatments of Social Phobia - Their Nature and Effects

The Treatments of Social Phobia - Their Nature and Effects

... inadequacy on the part of the patients foreseeing failure in achieving their social aims The second approach by contrast, de-emphasizes the formal/structural aspects of the proper performance of social ... at the end of treatment and at 1-year follow-up The combination of psychological treatments and medication was on the whole disappointing: in the studies under review it did not exceed the effects ... namely, the putative therapeutic processes provided by the treatments and their ability to undo the corresponding hypothetical causes of social phobia postulated by each approach First, as all treatments...
  • 46
  • 408
  • 0
Tài liệu Implementation of the Asthma Practice Guideline in the Army Medical Department - Evaluation of Process and Effects pdf

Tài liệu Implementation of the Asthma Practice Guideline in the Army Medical Department - Evaluation of Process and Effects pdf

... States Army under Contract No DASW0 1-0 1-C-0003 Library of Congress Cataloging -in- Publication Data Implementation of the asthma practice guideline in the Army Medical Department : evaluation of process ... MG31 9-1 .1 Command in December 1999 Army- wide implementation began in spring 2000 for the low back pain guideline, in Fall 2000 for the asthma guideline, and in early 2001 for the diabetes guideline Overview ... exacerbations of asthma Introduction As part of the process of developing the asthma guideline, the DoD/VA working group responsible for developing the asthma practice guidelines established a set of performance...
  • 212
  • 442
  • 0
Tài liệu Increasing Participation in Army Continuing Education - eArmyU and Effects of Possible Program Changes pptx

Tài liệu Increasing Participation in Army Continuing Education - eArmyU and Effects of Possible Program Changes pptx

... Congress Cataloging -in- Publication Data Increasing participation in Army continuing education : eArmyU and effects of possible program changes / Bruce R Orvis [et al.] p cm “MG-293.” Includes bibliographical ... enrolling in eArmyU are not planning to separate from the Army in the near term 11 12 Increasing Participation in Army Continuing Education Table Soldiers’ Likelihood of Participating in eArmyU ... peer review to ensure high standards for research quality and objectivity Increasing Participation in Army Continuing Education eArmyU and Effects of Possible Program Changes Bruce R Orvis, Laurie...
  • 103
  • 316
  • 0
Tài liệu Grid Database Access and Integration: Requirements and Functionalities pptx

Tài liệu Grid Database Access and Integration: Requirements and Functionalities pptx

... different requirements and potential functionalities of Grid Database Services, and (ii) the relationship between database and other services supported within The Grid Requirements for Grid Database ... an overview of requirements and functionalities for Grid Database Access and Integration Services It is not claimed that the requirements are complete Nor is it claimed that the functionalities ... Overview of Database Access and Integration Services 3 Requirements for Grid Database Services 3.1 Data Sources and Resources 3.2 Data Structure and Representation...
  • 25
  • 253
  • 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

... GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA ... GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT ... TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT AGCCATGGTTT AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC GCGGCCGCAAA GGCTGCACGACACTCCGCCATGGCTAGACGCTTTC CGTCTAGCCATGGCGGAGTGTCGTGCAGCCTCCAGG CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG...
  • 15
  • 597
  • 0
Credit Growth and the Effectiveness of Reserve Requirements and Other Macroprudential Instruments in Latin America pdf

Credit Growth and the Effectiveness of Reserve Requirements and Other Macroprudential Instruments in Latin America pdf

... borrowing.2 A summary of the recent use of macroprudential measures in Latin America is reported in Table Despite their increasing use, the effectiveness of macroprudential policies in leaning against ... measure the changes in RRs and in other macroprudential policies Our findings indicate that RRs and other macroprudential policies lead to a moderate and transitory slowdown in the growth of bank credit ... “lean against the wind”: (i) raising RRs during the upswing phase of the cycle to contain excessive credit growth and the associated build up of vulnerabilities and (ii) lowering them during the downswing...
  • 29
  • 525
  • 0
Nematode Economic Thresholds: Derivation, Requirements, and Theoretical Considerations pptx

Nematode Economic Thresholds: Derivation, Requirements, and Theoretical Considerations pptx

... C and D, respectively (Fig 2) producing economic threshold estimates of 22 and 125 for the control practice considered By m a n i p n l a t i o n and consideration of the curves in Figs l and ... ftmctions and economic thresholds are corrected for extraction efficiency so that they can be adapted to other extraction systems CONCLUSIONS Data needed for considerations of economic and optimizing ... by one nematode, P is the nematode p o p u l a t i o n level, and T is the tolerance level below which damage is not measurable Assume these parameters to have values C = 1,000, Z = 0.995 and T...
  • 10
  • 314
  • 1
Key Differences Between National Bank Regulatory Requirements and Federal Savings Association Regulatory Requirements pptx

Key Differences Between National Bank Regulatory Requirements and Federal Savings Association Regulatory Requirements pptx

... Key Differences between National Bank Regulatory Requirements and Federal Savings Association Regulatory Requirements I GENERAL POWERS AND OPERATIONAL REQUIREMENTS Lending/Investment Powers Federal ... applicable to both national banks and federal savings associations: see Appendix A to 12 C.F.R Part 30 (national banks) and Appendix A to 12 C.F.R Part 170 (federal savings associations) 14 Twelve ... applications are processed for federal savings associations and national banks, which is described below Federal Savings Associations The OCC must notify the federal savings association of OCC’s receipt...
  • 33
  • 338
  • 0
A review of the environmental fate and effects of hazardous substances released from electrical and electronic equipments during recycling: Examples fromChina and India doc

A review of the environmental fate and effects of hazardous substances released from electrical and electronic equipments during recycling: Examples fromChina and India doc

... lessen hazardous emissions from global WEEE, as well as to improve the recovery of valuable substances contained therein Conclusion This review of data on the environmental fate and effects of hazardous ... the Control of Transboundary Movements of Hazardous Wastes and their Disposal Despite the existence of these agreements and conventions, the transfer of WEEE from the United States, Canada, Australia, ... predominates Open burning, dumping of ashes and wastewater The NS authors also sampled in residential areas Guiyu, China (Lianjiang and Nanyang rivers) Guiyu, China Separation and recovery of metals...
  • 14
  • 825
  • 1
OIL AND GAS BONDS - Bonding Requirements and BLM Expenditures to Reclaim Orphaned Wells doc

OIL AND GAS BONDS - Bonding Requirements and BLM Expenditures to Reclaim Orphaned Wells doc

... 3: Number of Wells and BLM Expenditures to Reclaim Orphaned Wells, by State, Fiscal Years 1988–2009 Page i 11 17 18 GAO-1 0-2 45 Oil and Gas Bonds Table 4: Number of Orphaned Wells, Wells with a ... for any findings and conclusions Page 33 GAO-1 0-2 45 Oil and Gas Bonds Appendix II: Information on BLM Held Oil and Gas Bonds Appendix II: Information on BLM Held Oil and Gas Bonds This appendix ... 2009 126,583 Wyoming Total 295 $3,772,688 Source: GAO analysis of BLM data Page 17 GAO-1 0-2 45 Oil and Gas Bonds Table 3: Number of Wells and BLM Expenditures to Reclaim Orphaned Wells, by State,...
  • 58
  • 455
  • 0
SEIGNIORAGE, RESERVE REQUIREMENTS AND BANK SPREADS IN BRAZIL pptx

SEIGNIORAGE, RESERVE REQUIREMENTS AND BANK SPREADS IN BRAZIL pptx

... deposit and lending rates; direct and indirect taxes explain an additional 30% and the net bank margin the remaining 35% (Banco Central Brasil, 2001) The sharp decline in spreads between 1996 and ... for deposit banks Bank seigniorage revenue (or inflationary revenue) is the increase in non-interest bearing demand deposits (∆DD) minus the increase in non-interest bearing required reserves (∆RR).5 ... from the banking sector to the Central Bank helped to finance government spending as inflation ebbed, but it also put the banking sector at risk Lending interest rates and bank spreads increased...
  • 39
  • 403
  • 0
THE PLANNING OF A CUSTOMER RELATIONSHIP MANAGEMENT PROJECT: REQUIREMENTS AND OPPORTUNITIES pptx

THE PLANNING OF A CUSTOMER RELATIONSHIP MANAGEMENT PROJECT: REQUIREMENTS AND OPPORTUNITIES pptx

... x% of the offer acceptance rate, which is the equivalent of an average increase of revenues with more then y% annually The top management of a company appreciates that the CRM project application ... will allow the achievement of the fundamental objective that consists in the augmentation of the market share, by the means of the campaigns focalized on the reduction of the churn rate and the ... the acquisition of hardware equipments and the implementation of software applications, the network configuration, the system testing, the training of its users and the creation of a plan that...
  • 8
  • 433
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Models for Sentence Compression: A Comparison across Domains, Training Requirements and Evaluation Measures" docx

... text and spontaneous speech as it has been scripted beforehand and is usually read off an autocue One stumbling block to performing a comparative study between written data and speech data is that ... president has left for three days of speeches and fundraising in Nevada, California and New Mexico g: The president left for three days of speeches and fundraising in Nevada, California and New ... an approach through word extraction and a method for evaluation IEICE Transactions on Information and Systems E87-D(1):15–25 Jing, Hongyan 2000 Sentence Reduction for Automatic Text Summarization...
  • 8
  • 258
  • 0

Xem thêm

Từ khóa: vaccination certificate requirements and health advice for international travelcauses and effects of ozone holeforeign direct investment in china determinants and effectscauses and effects of environmental pollution pdfcauses and effects of the war of austrian successioncauses and effects of the war of spanish successionBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP