Formation of the possessive case

Formation of the possessive case

Formation of the possessive case
... The possessive of a proper noun denoting a trade, profession or relationship can often be used to denote a building or place of business She has gone to the baker’s (= baker’s ... to the baker’s (= baker’s shop) Tonight we are dining at Smith’s (= Smith’s house) Stay on top of your writing! Download our grammar guide from to stay up-to-date Powered...
  • 2
  • 20
  • 0

Tài liệu Cách thành lập số nhiều ( Formation of the plural) pptx

Tài liệu Cách thành lập số nhiều ( Formation of the plural) pptx
... Ex : brother-in-law => brothers-in-law Passer-by => passers by ...
  • 2
  • 192
  • 0

Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx

Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx
... the anion protein interactions in A-state stabilization Competition among anions To better define the effect produced by monovalent anions on the sulfate-induced A-state of cytochrome c, we monitored ... environment of the sulfate-induced A-state of cytochrome c, as observed from changes induced in the 416 nm Cotton effect (sulfate concentration: 50 mM) The effect of sulfate (.) concentration on the ... eukaryotic c class cytochromes [27]; anions exert a strong influence on the lysine residues of cytochrome c, and significantly affect the structure and the functional properties of the protein, as the conserved...
  • 11
  • 188
  • 0

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR products, ... [15] Metabolic control analysis has helped us to characterize the role of the individual genes in an operon and, to some extent, explain why L lactis may benefit from the way in which the las operon ... upstream to the las operon The plasmid pLB85 harbouring attP of TP901-1 and a promotorless gusA gene encoding b-glucuronidase [21] was used as plasmid vector for site-specific integration of extra gene...
  • 12
  • 195
  • 0

Tài liệu Báo cáo Y học: The insert within the catalytic domain of tripeptidyl-peptidase II is important for the formation of the active complex potx

Tài liệu Báo cáo Y học: The insert within the catalytic domain of tripeptidyl-peptidase II is important for the formation of the active complex potx
... for formation of the TPP II complex Ó FEBS 2002 Formation of the tripeptidyl-peptidase II complex (Eur J Biochem 269) 1443 This amino acid is located in the insert within the catalytic domain, ... types of homodimers The insert within the catalytic domain is of importance for complex formation No functional significance has previously been ascribed to the insert between Asp and His of the ... to the catalytic His264, and the proximity to the active site may explain the effect of oligomerization on enzyme activity Even though the exact mechanism for complex formation and activation of...
  • 6
  • 206
  • 0

Formation of the Union pdf

Formation of the Union pdf
... Formation of the Union The second volume of the EPOCHS OF AMERICAN HISTORY aims to follow out the principles laid down for "THE COLONIES," the study of causes rather than of events, the development ... side, the one towards a union of the colonies, the other towards independence Of these the current of union had run a little faster Notwithstanding the authority which they had set over themselves, ... claims.] Southwest of the territory of the Iroquois lay the region of the upper Ohio and its tributaries, particularly the valleys of the Tennessee, the Muskingum, the Allegheny, the Monongahela...
  • 131
  • 131
  • 0

Báo cáo Y học: Introducing Wilson disease mutations into the zinc-transporting P-type ATPase ofEscherichia coli The mutation P634L in theÔhingeÕ motif (GDGXNDXP) perturbs the formation of the E2P state pdf

Báo cáo Y học: Introducing Wilson disease mutations into the zinc-transporting P-type ATPase ofEscherichia coli The mutation P634L in theÔhingeÕ motif (GDGXNDXP) perturbs the formation of the E2P state pdf
... deviation of three to four measurements In addition to measuring the formation of aspartyl phosphate, the catalytic cycle of a P-type ATPase can be characterized by determining the decay rate of the ... changes in Mg2+ ligation so that in the E1 state Mg2+ is ligated by residues in the hinge motif in the P domain and by residues in the N domain, whereas in the E2 state the latter are replaced by residues ... Dephosphorylation assays The rate of dephosphorylation of the phosphoenzyme intermediate was determined both in the absence of ADP (dephosphorylation via the E2P intermediate) and in the presence of...
  • 8
  • 171
  • 0

The formation of the plural noun in English and Vietnamese equivalents

The formation of the plural noun in English and Vietnamese equivalents
... compare the differences between the formation of plural nouns in English and in Vietnamese 36 Chapter two :The formation of plural nouns in English and Vietnamese equivalents In English, the English ... reference books and on the internet to select the valuable information relating to the theme the forming of the plural nouns in English and Vietnamese equivalents Therefore, the content of the study ... similarities and the differences between the ways of the formation of plural nouns and I hope that the study will help English learners know about the formation of the plural nouns in English and Vietnamese...
  • 77
  • 186
  • 1

Báo cáo khoa học: Hatching enzyme of the ovoviviparous black rockfish Sebastes schlegelii – environmental adaptation of the hatching enzyme and evolutionary aspects of formation of the pseudogene docx

Báo cáo khoa học: Hatching enzyme of the ovoviviparous black rockfish Sebastes schlegelii – environmental adaptation of the hatching enzyme and evolutionary aspects of formation of the pseudogene docx
... Scorpaeniformes within the Euteleostei [15] The hatching enzyme was identified from ovarian fluids of the black rockfish, and the cDNAs and the genes for the hatching enzyme were cloned from the embryos Results ... secreted from hatching gland cells to digest the chorion In this study, we observed the embryo hatching of the ovoviviparous black rockfish Sebastes schlegelii, which is a member of the Scorpaeniformes ... embryos, ovoviviparous fish embryos grow and hatch within the maternal body and are then delivered from the body At the time of ovoviviparous fish hatching, it has been unclear whether the hatching enzyme...
  • 15
  • 161
  • 0

Báo cáo khoa học: Cytochrome P460 of Nitrosomonas europaea Formation of the heme-lysine cross-link in a heterologous host and mutagenic conversion to a non-cross-linked cytochrome c ¢ pot

Báo cáo khoa học: Cytochrome P460 of Nitrosomonas europaea Formation of the heme-lysine cross-link in a heterologous host and mutagenic conversion to a non-cross-linked cytochrome c ¢ pot
... oligonucleotides were 5¢- GTAACTGTAAGAGAACTGGTCAC- (Lys70 to Arg), 5¢- GTAACTGTAGCAGAACTGGTCA G- (Lys70 to Ala), and 5¢- GGTAACTGTATATGAA CTGGTCAG- (Lys70 to Tyr) The resulting plasmids, pUCYPKR, ... spectrum Although catalytic activity was lost in the mutants, the ligand-binding capability and thus the pentacoordinate nature of the heme was conserved Significantly, typical c -cytochrome a and ... Arciero as described earlier [22] for use as an electron acceptor in assays of hydroxylamine and hydrazine oxidation by cytochrome P460 In these assays, the absorbance of lM cytochrome c5 52 in...
  • 7
  • 126
  • 1

Báo cáo khoa học: A hydrophobic segment within the C-terminal domain is essential for both client-binding and dimer formation of the HSP90-family molecular chaperone pptx

Báo cáo khoa học: A hydrophobic segment within the C-terminal domain is essential for both client-binding and dimer formation of the HSP90-family molecular chaperone pptx
... [26] that they form a dimer in an antiparallel fashion through a pair of the interactions between the middle domain and the C-terminal domain Similarly, the C-terminal 326 amino acids of barley ... roles of the C-terminal domain of HSP90 (Eur J Biochem 270) 147 and geldanamycin, a specific inhibitor of HSP90 molecular chaperone; and the other is in the C-terminal domain Minami et al [16] and ... region of the C-terminal domain sufficient for dimerization with the middle domain The C-terminus of the C-terminal domain (Leu619– Asp732) of human HSP9 0a was serially truncated, and the binding activity...
  • 9
  • 128
  • 0

Báo cáo Y học: The presence of phosphate at a catalytic site suppresses the formation of the MgADP-inhibited form of F1-ATPase potx

Báo cáo Y học: The presence of phosphate at a catalytic site suppresses the formation of the MgADP-inhibited form of F1-ATPase potx
... which are in the normal range for thermophilic F1-ATPase activity ATP hydrolysis assay ATP hydrolysis was measured using an ATP-regenerating system as a decrease in A3 40 of NADH at 25 °C The assay ... an analog of phosphate, indeed Ó FEBS 2002 binds near the c phosphate position of ATP at a catalytic site [38] As previously proposed [18], the presence of Pi at a catalytic site may shift the ... Effect of Pi on MgADP binding to catalytic sites Formation of the MgADP-inhibited form is caused by entrapment of inhibitory MgADP in a catalytic site [5±9] Fig Prevention of the formation of the MgADP-inhibited...
  • 8
  • 154
  • 0

Báo cáo hóa học: " Hydrothermal Formation of the Head-to-Head Coalesced Szaibelyite MgBO2(OH) Nanowires" pot

Báo cáo hóa học:
... corresponding change of the average aspect ratio of the hydrothermal product with the droplet size of the NaOH solution (Fig 2c) Remarkably, the average aspect ratio of the hydrothermal product significantly ... All of the reactants were analytical grade without further purification To investigate the hydrothermal formation of the MgBO2(OH) nanowires, the dropping rate, droplet size, and amount of the ... the significant effect of the feeding mode on the morphology and size distribution of the hydrothermal product, which resulted in the head-to-head coalesced MgBO2(OH) nanowires with a length of...
  • 8
  • 49
  • 0


... used without the auxiliary, the Simple Past form of the verb is used For regular verbs, and for many irregular verbs, the Simple Past has the same form as the past participle **** The other modal ... with the Simple Present or Simple Past of the verb to be ** When used without the auxiliary, the third person singular of the Simple Present, in the Indicative Mood of the Active Voice, has the ... participle past participle * In the Simple Present and Simple Past tenses of the Active Voice, the auxiliaries are used only for emphasis, and for the formation of questions and negative statements Auxiliaries...
  • 9
  • 125
  • 0

Xem thêm

Nạp tiền Tải lên
Đăng ký
Đăng nhập