0
  1. Trang chủ >
  2. Ngoại Ngữ >
  3. Ngữ pháp tiếng Anh >

Transformation of sentences

Báo cáo khoa học:

Báo cáo khoa học: "Machine-Learning-Based Transformation of Passive Japanese Sentences into Active by Separating Training Data into Each Input Particle" doc

... data This indicates that our method of separating training data for all source particles is effective The transformation of passive sentences into active sentences is useful in many research ... separate training data for any source particles obtained an accuracy rate of 92.00% in Eval B The technique of separating training data into each source particles made an improvement of 2.30% ... particles when transforming Japanese passive sentences into active sentences Our method separates training data for all input (source) particles and uses machine learning for each particle We also...
  • 8
  • 426
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Machine-Learning-Based Transformation of Passive Japanese Sentences into Active by Separating Training Data into Each Input Particle" ppt

... cues from the training data (and also the test data) We also generated another set of training data by removing the majority countability features from them This set of training data was used ... included in training data For simplicity of implementation, they are excluded from training data (we will discuss the use of these excluded data in Section 6) Generating Training Data As discussed ... about 10% of all texts, were randomly taken to obtain test data The rest of texts were used to generate training data We evaluated performance of prediction by accuracy We defined accuracy by the...
  • 8
  • 305
  • 0
The transformation of the American class structure, 1960-1990

The transformation of the American class structure, 1960-1990

... expand The basic hypotheses of Marxist and postindustrial perspectives are summarized in Table 3.1 American class structure, 1960±1990 59 Table 3.1 Hypotheses for transformations of the American class ... working class is 54% of the labor force ± nevertheless, the trajectory of change is more in keeping with the expectations of post-industrial theory than traditional Marxism American class structure, ... to the overall change in class distributions is thus referred to as the interaction component Because of limitations of sample size, for the analyses of this chapter the 12 categories of the class...
  • 11
  • 540
  • 1
Tài liệu The Transformation of Banking and Its Impact on Consumers and Small Businesses docx

Tài liệu The Transformation of Banking and Its Impact on Consumers and Small Businesses docx

... passed on to small businesses in the form of lower prices Despite these positive aspects of the transformation of banking, one important concern remains about the impact on local economies—with the ... Source: Summary of Deposits, National Information Center Database II IMPACT OF THE CHANGES ON CONSUMERS Consumers have traditionally relied on nearby banks and branches for many of their banking services ... Will the transformation of banking now under way hurt consumers by raising the price or reducing the quality of these services? Or will the changes benefit consumers by expanding the array of services...
  • 29
  • 497
  • 1
Tài liệu THE REINVENTION OF GENIUS WAGNER''''S TRANSFORMATION OF SCHOPENHAUER''''S AESTHETICS IN “BEETHOVEN” ppt

Tài liệu THE REINVENTION OF GENIUS WAGNER''''S TRANSFORMATION OF SCHOPENHAUER''''S AESTHETICS IN “BEETHOVEN” ppt

... 'movement of the soul', while by contrast in the experience of the beautiful we remain in restful contemplation Furthermore, the experience of the sublime involves the concept of infinitude Finally, the ... that of the movement of the soul and that of a feeling of infinitude, seems clearly on Wagner's mind where he associates the sublime with the 'highest ecstasy of consciousness of our infinitude' ... beautiful and the sublime are distinguished by the manner in which the pure subject of knowing detaches itself from the subject of willing In the contemplation of beauty, the pure subject of knowing has...
  • 10
  • 279
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "ON THE AUTOMATIC TRANSFORMATION OF CLASS MEMBERSHIP CRITERIA" docx

... to the matching process The transformation is performed by means of a process of ~ inmtRntlat~nn OF the deflnition the translation of the de/initlon f~'om a set of criteria for satisfying the ... instances of the type CONTROL (CI, C2), and ~wo instances of PROPERTY (06, 09) were used The value of MAKEFULLLIST shows the survivors of STAGEI The value of BGO shows the single valid instance of a ... Figure I; the arcs represent relations, and the nodes represent the types of the instances between which the relations may ho]d Several of the pattern-directed inference rules input to the transformation...
  • 6
  • 366
  • 0
Direct growth of amorphous silica nanowires by solid state transformation of sio2 films

Direct growth of amorphous silica nanowires by solid state transformation of sio2 films

... decomposition of TiN, as a result, it limits the growth of a-SiONWs nanowires by the mechanism Oxygen seems Fig A schematic diagram showing a growth mechanism of silica nanowires by the solid solid transformation ... diffusion of silicon from the silica films The growth mechanism could be explained by direct solid to solid phase transformation, so called, the SS mechanism The TiN films react with the silica films ... the nanowires and cause the silicon diffusion by the internal stress Our result suggests a novel growth mechanism for growth of nanowires, and can be applied to the synthesis of other kind of nanowires...
  • 5
  • 384
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Acquisition of a Lexicon from Semantic Representations of Sentences*" ppt

... [ingest,pat:[food,type:pasta]], [food,type:pasta], [food], and [pasta] Since all of these have 100% coverage in this example set, any of them could be chosen as the meaning representation for p a s t a Again, for clarity, ... percentage of this overlap At each iteration, the first step is to find and add to the output this best (w,t) pair Note that t can also be part of the representation of a large percentage of sentences ... alternatives for the meanings for p a s t a , and also for window and cheese In a larger example, some of these ambiguities would be eliminated, but those remaining are an area for future research...
  • 3
  • 246
  • 0
Gradual phase and morphology transformation of Fe3O4nanoparticles to a - FeOOH nanorods in alcohol/water mediain the presence of surfactant F127

Gradual phase and morphology transformation of Fe3O4nanoparticles to a - FeOOH nanorods in alcohol/water mediain the presence of surfactant F127

... nanorods are a- FeOOH The gradual phase transformation from Fe3O4 to a- FeOOH with increasing volume ratios of alcohol/water is consistent with XRD results well The magnetism of the samples prepared in ... with 52% of Fe3O4 in mass and 48% of a- FeOOH in mass Results and discussion Figure shows XRD patterns of the samples prepared in pure water and in alcohol/water media XRD pattern of Fig 1a matches ... It reveals the coexistence of two phases in the product From the above results, a gradual phase transformation from Fe3O4 to a- FeOOH can be seen with increasing volume ratios of alcohol/water Fig...
  • 4
  • 658
  • 0
Báo cáo

Báo cáo " Vector construction and transformation of 4CL1 gene into Chinaberrytree (Melia azedarach L.)" ppt

... Transform vector pPTN289 -4CL1 into Chinaberrytree (Melia azedarach L.) and tested the existence of 4CL1 gene using PCR method Leaf disc transformation of Chinaberrytree (Melia azedarach L.) was ... plasmid and tested the Figure Testing the existence of 4CL1 using PCR method (line and 2) and NcoI/XbaI double digestion (line and 4) 3.3 Transformation of vector pPTN289 -4CL1 into Chinaberrytree and ... line 1, vector pBT -4CL1 was digested into bands, the first band (about 2.7kb) is the linear backbone of vector pBT, and the another band (about 1.6kb) is 4CL1 gene In line 2, vector pPTN289 was...
  • 7
  • 302
  • 1
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx

Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx

... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... was and lg for placenta (lanes and 2, respectively) and 20 lg for the skin samples Side-chain cleavage of 7-DHC by placental and adrenal mitochondria Incubations were carried out as described for ... human skin, normal epidermal and immortalized keratinocytes, dermal fibroblasts, squamous cell carcinoma and five human melanomas Thus, these data clarify in detail the cutaneous expression of the...
  • 11
  • 475
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Evaluation of Importance of Sentences based on Connectivity to Title" doc

... System for Automating Concordance Line Selection In Proceedings of NeMLaP, pages 95-100 H P Ednmndson 1969 New Methods in Automatic Extracting Journal of the ACM, 16(2):264-285 T Givon 1979 From ... 1958 The Automatic Creation of Literature Abstracts IBM Journal for Research and Development, 2(2):159-165 ~ ~ { ~ K Ono, K Sumita, and S Miike 1994 Abstract Generation based on Rhetorical Structure ... Rhetorical Structure Extraction In Proceedings of COLING, pages 344-348 ~ ~ G Salton, J Allan, C Buckley, and A Singhal 1994 Automatic Analysis, Theme Generation, and Summarization of Machine-Readable...
  • 5
  • 333
  • 0

Xem thêm

Từ khóa: semantic representations of sentencesevaluation of importance of sentencessemantic representation of sentencesexamples of sentences with action and linking verbsenglish to urdu translation online of sentencesroman urdu to english translation online of sentencesenglish to urdu translation of sentences free onlinegoogle english to urdu translation online of sentencesexamples of sentences using countable and uncountable nounswhat is the energy transformation of a toy carurdu to english translation online of sentencesthe transformation of the american party systemthe functions of sentencesanalysis of the endocardial to mesenchymal transformation of heart valve development by collagen gel culture assayevolution and revolution enduring patterns and the transformation of latin american bureaucracyBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP