Performance Studies on a Downdraft Biomass Gasifier with Blends of Coconut Shell and Rubber Seed Shell as Feedstock

Some studies on a probabilistic framework for finding object-oriented information in unstructured data

Some studies on a probabilistic framework for finding object-oriented information in unstructured data
... framework for finding object-oriented information in unstructured data Two above solutions can be plausible for solving object search problem Yet, the Information Extraction based solution has ... they also have some shortcomings Information Extraction based solution has low scalability and low adaptability while Text Information Retrieval based solution has high scalability but low adaptability ... VIETNAM NATIONAL UNIVERSITY, HANOI COLLEGE OF TECHNOLOGY TRAN NAM KHANH SOME STUDIES ON A PROBABILISTIC FRAMEWORK FOR FINDING OBJECT-ORIENTED INFORMATION IN UNSTRUCTURED DATA UNDERGRADUATE THESIS...
  • 51
  • 137
  • 0

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] The surE gene duplicated ... phosphate concentrations are high 5862 Materials and methods Cloning and purification of St SurE The SurE gene was PCR amplified from Salmonella enterica Typhimurum strain IFO12529 genomic DNA as...
  • 10
  • 223
  • 0

Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx
... Part of a two-dimensional 1H,13C HSQC spectrum of the O-specific polysaccharide (OPS) of Citrobacter braakii PCM 1531 One-dimensional 1H and 13C NMR spectra are displayed along the horizontal and ... immunodiffusion of anti (Citrobacter braakii PCM 1531) serum (A) and anti- (Citrobacter PCM 1487) serum (B) with lipopolysaccharide (LPS)-I (well 1) and LPS-II (well 2) of C braakii PCM 1531, and LPS of Citrobacter ... inhibition of passive haemagglutination, SDS/ PAGE and immunoblotting using O-antisera against C braakii PCM 1531 and PCM 1487 In double immunodiffusion (Fig 4), the LPS of C braakii PCM 1531 and PCM...
  • 7
  • 160
  • 0

báo cáo hóa học:" Research Article On a Nonlinear Integral Equation with Contractive Perturbation" pdf

báo cáo hóa học:
... funzioni misurabilli,” Bollettino della Unione Matematica Italiana B, vol 3, no 6, pp 497–515, 1984 16 J Bana´ and Z Knap, “Measures of weak noncompactness and nonlinear integral equations of s convolution ... functional integral equation on an unbounded interval,” Nonlinear Analysis Theory, Methods & Applications, vol 71, no 9, pp 4131–4136, 2009 11 B Ricceri and A Villani, “Separability and Scorza-Dragoni’s ... convolution type,” Journal of Mathematical Analysis and Applications, vol 146, no 2, pp 353–362, 1990 17 K Latrach and M A Taoudi, “Existence results for a generalized nonlinear Hammerstein equation on...
  • 10
  • 130
  • 0

Báo cáo hóa học: " Research Article On a Hilbert-Type Operator with a Class of Homogeneous Kernels" pptx

Báo cáo hóa học:
... Inequalities & c c c Applications, vol 8, no 1, pp 28–51, 2005 11 B Yang, On the norm of a Hilbert’s type linear operator and applications,” Journal of Mathematical Analysis and Applications, vol 325, ... theory of operators, we define a new Hilbert-type operator and obtain its norm As applications, an extended basic theorem on Hilbert-type inequalities with the decreasing homogeneous kernel of −λ-degree ... 2002 B Yang, On new extensions of Hilbert’s inequality,” Acta Mathematica Hungarica, vol 104, no 4, pp 291–299, 2004 B Yang, On best extensions of Hardy-Hilbert’s inequality with two parameters,”...
  • 9
  • 107
  • 0

Báo cáo hóa học: " Research Article On a Hilbert-Type Operator with a Symmetric Homogeneous Kernel of −1-Order and Applications" doc

Báo cáo hóa học:
... Bulletin of the Belgian Mathematical Society, vol 13, no 4, pp 577–584, 2006 [3] B Yang, On the norm of an integral operator and applications,” Journal of Mathematical Analysis and Applications, ... Yang, “Generalization of a Hilbert-type inequality with the best constant factor and its applications,” Journal of Mathematical Research and Exposition, vol 25, no 2, pp 341–346, 2005 [9] B Yang, ... certain multilinear integral operators,” Journal of Inequalities and Applications, vol 2006, Article ID 28582, 12 pages, 2006 [6] B Yang, On the norm of a certain self-adjiont integral operator...
  • 9
  • 165
  • 0

Báo cáo y học: "Effect of continuous positive airway pressure therapy on a large hemangioma complicated with obstructive sleep apnea syndrome: a case report" docx

Báo cáo y học:
... this article as: Antoniadou et al.: Effect of continuous positive airway pressure therapy on a large hemangioma complicated with obstructive sleep apnea syndrome: a case report Journal of Medical ... Structural changes, such as tonsilar hypertrophy, retrognathia, macroglossia, adenoid tissue and variations in craniofacial features, promote the occurrence of apneas and hypopneas due to anatomic narrowing ... involved, hemangioma may lead to life-threatening obstruction The diagnosis of a hemangioma is usually made on the basis of a patient’s history and clinical findings Ultrasonography is a useful imaging...
  • 4
  • 81
  • 0

Báo cáo y học: " Effect of continuous positive airway pressure therapy on a large hemangioma complicated with obstructive sleep apnea syndrome: a case report" doc

Báo cáo y học:
... this article as: Antoniadou et al.: Effect of continuous positive airway pressure therapy on a large hemangioma complicated with obstructive sleep apnea syndrome: a case report Journal of Medical ... Structural changes, such as tonsilar hypertrophy, retrognathia, macroglossia, adenoid tissue and variations in craniofacial features, promote the occurrence of apneas and hypopneas due to anatomic narrowing ... involved, hemangioma may lead to life-threatening obstruction The diagnosis of a hemangioma is usually made on the basis of a patient’s history and clinical findings Ultrasonography is a useful imaging...
  • 4
  • 77
  • 0

Báo cáo sinh học: " Optimum truncation points for independent culling level selection on a multivariate normal distribution, with an application to dairy cattle selection" pot

Báo cáo sinh học:
... unsatisfactory (Ducrocq and Colleau, 1986) Then alternative methods may have to be used (e.g., Russell et al., 1985) An application in the dairy cattle context Assumptions Dairy cattle selection is ... optimal situation may correspond to virtually no selection on type (weights 5:1) or to a culling on type evaluation of between a quarter and a half of the candidates (weights 2:1) on each path ... Our approach for the optimization of these successive selection stages relies on the assumption of multivariate normality for these criteria when candidates for selection are born Such an assumption...
  • 14
  • 71
  • 0

Genetic studies on a soil streptomyces sp that produces an antifungal compoud

Genetic studies on a soil streptomyces sp  that produces an antifungal compoud
... to a variety of fungal, bacterial, protozoal and viral diseases Species of Candida, Coccidioides, Histoplasma, and Aspergillus are important causative agents Of these, Candida species, especially ... can be isolated separately and are designated as type II FAS enzymes In contrast, mammalian FAS are large multifunctional proteins and are designated as type I FAS enzymes Various intermediate ... at a ‘transition stage’ as biomass changes from the quasi-exponential toward the stationary phase It has been suggested that such timing of antibiotic production and differentiation is adaptive...
  • 232
  • 83
  • 0

Indentation studies on a zr based bulk metallic glass

Indentation studies on a zr based bulk metallic glass
... anneal the metallic glass To investigate the effect of quasi-static deformation on nanocrystallization behaviour in the shear bands, they conducted nanoindentation experiments on metallic glass Zr5 2.5Cu17.9Ni14.6Al10Ti5 ... 2.6.3 Indentation Investigation on Metallic Glasses Indentation may introduce a constrained or stable stress field and thus provides a way to characterize multiaxial plastic deformation of BMGs at ... of bulk metallic glasses Keywords: Bulk metallic glass, Mechanical properties, Hardness, Shear band, Spherical indentation, Nanoindentation vi List of Tables 2-1 Alloy systems, years and maximum...
  • 119
  • 153
  • 0

On a fractional differential inclusion with integral boundary conditions in Banach space

On a fractional differential inclusion with integral boundary conditions in Banach space
... C Castaing, L X Truong, Second order differential conclusions with m-point boundary conditions, J Nonlinear Convex Anal to appear [6] C Castaing, P Raynaud de Fitte and M Valadier, Young measures ... functional differential equations of arbitrary orders, Nonlinear Anal 33 (1998), 181-186 [11] A M A El-Sayed, Sh A Abd El-Salam, Nonlocal boundary value problem of a fractional- order functional differential ... 1993 [17] A Ouahab, Some results for fractional boundary value problem of differential inclusions, Nonlinear Anal., 69 (2008) 3877-3896 [18] I Podlubny, Fractional Differential Equation, Academic...
  • 17
  • 49
  • 0

báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

báo cáo hóa học:
... of the sterility testing in compliance with eu Pharmacopoeia 2.6.1 (sterility) and the validation of the potency assay in an ATMP that is constituted of bone- marrow mononucleated cells used in ... using cell systems and in vivo assays using animal models As concerning the use of bone marrow mononucleated cells in cardiac repair, the importance of characterizing the functionality of injected ... is the validation of a commercial system (Charles River Endosafe PTS) for the determination of bacterial endotoxins in compliance with Eu Pharmacopoeia 2.6.14 (bacterial endotoxins), the validation...
  • 9
  • 193
  • 0

Báo cáo sinh học: "Aurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor de-differentiation" doc

Báo cáo sinh học:
... follows: AURKA.FW: GAGATTTTGGGTGGTCAGTAGATG, AURKA.RW: TAGTCCAGCGTGCCACAGAGA, ESD.FW:TGTTGTC ATTGCTCCAGATACCA, ESD.RW:CCCAGCTCTCAT CTTCACCTTT, POLR2B.FW:CCTGATCATAACCAG TCCCCTAGA,OLR2B.RW:GTAAACTCCCATAGCCT ... changes that characterize prostate cancer progression Cancer Res 2001, 61:2212-2219 Sakakura C, Hagiwara A, Yasuoka R, Fujita Y, Nakanishi M, Masuda K, Shimomura K, Nakamura Y, Inazawa J, Abe ... interpretation and drafted the manuscript MP and GVS participated in study design and coordination, data analysis and interpretation and drafted the manuscript All authors read and approved the final manuscript...
  • 6
  • 147
  • 0

o cáo hóa học:" Aurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor " potx

o cáo hóa học:
... invasion, metastasis, and prognosis Lung Cancer 2002, 36:115-124 doi:10.1186/1479-5876-9-100 Cite this article as: Lo Iacono et al.: Aurora Kinase A expression is associated with lung cancer histological-subtypes ... data interpretation and drafted the manuscript MP and GVS participated in study design and coordination, data analysis and interpretation and drafted the manuscript All authors read and approved ... Nicosia SV, Cheng JQ: Activation and overexpression of centrosome kinase BTAK /Aurora- A in human ovarian cancer Clin Cancer Res 2003, 9:1420-1426 Pihan GA, Purohit A, Wallace J, Malhotra R, Liotta...
  • 6
  • 147
  • 0

Xem thêm

Từ khóa: a study on a filter bank structure with rational scaling factors and its applicationsresearch studies of qigong therapy for cancer for the past 20 years in china were reviewed from three different categories clinical study on human cancer patients in vitro study of cancer cells and in vivo study of cancer with qigong therapthe road goes ever on a christian journey through the lord of the rings1 a relevant person must apply on a risk sensitive basis enhanced customer due diligence measures and enhanced ongoing monitoring—neuro knowledge model based on a pid controller to automatic steering of shipsa comparison among ekf with bias tracking cubature pf and cost reference pf2 a — pavement thickness mm with integral or tied curb and gutter or shoulders supported edgesthe branch of medicine concerned with diseases of the stomach and intestines isa specialist in diagnosing and treating disorders of the stomach and intestine is known asthere are 3 types of markets which play a prominent role in organized marketing of fruits vegetables and flowers these include farmers markets village haats assembly markets terminal markets and regulated marketsbank s corporate governance policies and practices by monitoring a combination of internal reports and prudential reports including as appropriate reports from third parties such as external auditorsregional trends and associations of outcome indicators with indicators of policy pillars and good governanceimagine that you have just received a donation of one million dong from one of the local organizations to build your school library use the suggestions in task 1 to write a letter to acknowledge the receipt of the donation and express your gratitudethe art of r programming takes you on a guided tour of software development with rwhat not to say on a first date with a guyGiáo án Vật lí 11 Chương trình chuẩnGiáo án vật lí 12 chương trình chuẩnGiáo án dạy đội tuyển casio vật líchuong 2 gia tri thoi gian cua tien(1)ThS.Phan Anh Thế Phân biệt một số triệu chứng trên lá cây có múiHợp tác công tư trong lĩnh vực cấp nước sạch tại Việt Nam (LA tiến sĩ)bài tập nâng cao sinh học 9 hayVấn đề ô nhiễm môi trườngTiểu luận Tìm hiểu phần mềm kế toán Fast AccountingTiểu luận Tin học kế toán Phân tích ứng dụng Excel kế toánTiểu luận tin học quản lý Tình hình sử dụng internet của giới trẻ trình độ caotiểu luận Xác định và hạch toán các khoản dụ phòng trong doanh nghiệpTiêu thụ sản phẩm tại công ty liên doanh LG- MECA ELECTRONICS – thực trạng và giải pháp thúc đẩyTÌM HIỂU HỆ THỐNG XỬ LÝ NƯỚC THẢI CHẾ BIẾN CẤP ĐÔNG RAU QUẢ CÔNG SUẤT 300 m3 ngàyđêmTìm hiểu hoạt động xây dựng và phát triển thƣơng hiệu bánh xèo Mƣời XiềmTÌM HIỂU MÁY TEMSTÌM HIỂU PHÉP TOÁN HÌNH THÁI, PHƯƠNG PHÁP DI TRUYỀN VÀ ỨNG DỤNGTÌM HIỂU PHƯƠNG PHÁP THIẾT KẾ ĐỘNG CƠ KHÔNG ĐỒNG BỘ VẠN NĂNGVận dụng mô hình phân tích SWOT khi lập kế hoạch chuyên môn nhằm nâng cao chất lượng học sinh tại trường THPT Nguyễn DuBảo Quản Rau Quả Bằng Phương Pháp Màng
Nạp tiền Tải lên
Đăng ký
Đăng nhập