a specialist in diagnosing and treating disorders of the stomach and intestine is known as
Báo cáo khoa học: Antimicrobial and conformational studies of the active and inactive analogues of the protegrin-1 peptide docx
Ngày tải lên :
22/03/2014, 21:20
... A, Marigliano A, Della
Vittoria A, Nadolski P et al. (2007) In- vitro activity of
the synthetic protegrin IB-367 alone and in combination
with antifungal agents against clinical isolates of
Candida ... antimicrobial
activity of IB-367 and BM-1 against Gram-negative
bacteria was similar, however. Interestingly, BM-2,
inactive against bacteria, displayed a better antifungal
activity than either IB-367 ... IB-367 and BM-1
exhibited antimicrobial activity against all the bacteria,
but were less active against the fungi (see Table 1). In
contrast, BM-2 showed a marked decrease in activity
against all the...
- 13
- 427
- 0
Báo cáo khoa học: Coexpression, purification and characterization of the E and S subunits of coenzyme B12 and B6 dependent Clostridium sticklandii D-ornithine aminomutase in Escherichia coli potx
Ngày tải lên :
30/03/2014, 15:20
... GGGGGATCCCCATAATCCACTCCACCTGCTAAA
44 GGGGGGGATCCT CATTATTTCCCTTCT
66 AATACCGCCATGTATAATATCTATTACTTC
67 GTAATAGATATTATACATGGCGGTATTGAA
75 GGGGGGGCCATGGAAAGAGCAGACGATTT
4294 H P. Chen et al.(Eur. ... standard [6]. The
Table 1. PCR primer names and seq uences.
Primer
name Sequence
21 GGGTCTAGAATGGAAAAAGATCTACAGTTAAGA
33 CCGGAATTCTTATTTCCCTTCTCTCATCTC
40 GCGCGCCATGGAAAAAGATCTACAGTTAAGA
41 GGGGGATCCCCATAATCCACTCCACCTGCTAAA
44 ... Chemistry, Academia Sinica, Nankang, Taipei, Taiwan
D
-Ornithine aminomutase from Clostridium sticklandii
comprises two strongly associating subunits, OraS and
OraE, with molecular masses of 12 800 and...
- 5
- 401
- 0
Tài liệu STRATIGRAPHY AND AMMONITE FAUNA OF THE VOLGIAN AND BERRIASIAN ROCKS OF EAST GREENLAND ppt
Ngày tải lên :
17/02/2014, 20:20
...
PLATE
VII.
1v
Stratigraphy
and
Anr~nonite Fauna of East
Greenland
13
the same as the gradient of the stream, and for
this reason it was found
impossible to correlate or place in stratigraphical ... Garniericeras,
Snbcraspedirrs and Pnrncrnspedites. Snbcra-
spedites is placed in Tollinae, as explained below. Paracrapedites is also
excluded (see
CASEY 1962). Garniericeras was made the type ... an Upper IIartzfjdd Sandstone,
of early
Cretaceolis date, comprising the remainder of the formation.
In south-western Jameson Land the Hectoroceras Beds arc of
Berriasian age.
Tn the Niesrn...
- 50
- 451
- 0
Báo cáo khoa học: Interaction of the E2 and E3 components of the pyruvate dehydrogenase multienzyme complex of Bacillus stearothermophilus ppt
Ngày tải lên :
16/03/2014, 18:20
... pyruvate
dehydrogenase complexes. Proc Natl Acad Sci USA 96,
1240–1245.
17 Takenaka A, Kizawa K, Hata T, Sato S, Misaka E-J,
Tamura C & Sasida Y (1988) X-ray study of baker’s
yeast lipoamide dehydrogenase at ... responsible for
binding E3 in the majority of organisms. In icosahe-
dral complexes, the PSBD is also involved in the bind-
ing of E1 [1,2]. The catalytic (acyltransferase) core
domain, which assembles ... the octahedral or
icosahedral inner core of the complexes, is proposed to
bind E1 in the octahedral complexes [2,3], and is loca-
ted at the C-terminus. Each of the individual domains
is separated...
- 10
- 558
- 0
Báo cáo khoa học: Characterization of the lipopolysaccharide and b-glucan of the fish pathogen Francisella victoria ppt
Ngày tải lên :
30/03/2014, 10:20
... acid (homoalanine or
BABA), and a novel branched amino acid designated
AA. HMBC correlations allowed us to trace the
BABA-acylated alanine, which was in turn linked to
N-4 of terminal Fuc4N residue ... development against
fish diseases and possibly against tularemia in humans.
Here we present the results of the structural analysis of
the lipopolysaccharide of the first known fish Francisel-
la sp., ... The
membranes were then washed and further reacted with a
1 : 4000 dilution of second antibody, goat antirabbit IgG
conjugated to alkaline phosphatase (Caltag Laboratories,
Burlingame, CA, USA) and...
- 12
- 397
- 0
Báo cáo khoa học: Stabilities and activities of the N- and C-domains of FKBP22 from a psychrotrophic bacterium overproduced in Escherichia coli pptx
Ngày tải lên :
23/03/2014, 13:20
... 2).
Enzymatic activity
The PPIase activity was determined by protease-coupling
assay [31,32] and RNase T
1
refolding assay [33]. For the
protease-coupling assay, chymotrypsin was used as the
protease ... 5Â-AGAGAGAA
TT
CATATGTCAGATTTGTTCAG-3Â for N-domain
+
,5Â-
CTGAAAACGCTAAG
CATATGGGTATTACGA-3Â for
C-domain
, and 5Â-CTTGCTGATGCACATATGGGGAA
AGAAAGC-3Â for C-domain
+
, where underlined bases
show the position of the NdeI ... proteins remain to be analyzed. Because the
prolyl isomerization is a spontaneous reaction and the
rate for this reaction increases as the reaction tempera-
ture increases, the PPIase activity cannot...
- 11
- 332
- 0
Comparing the cultural and linguistic analysis of the English word “meal” and words relating to it in contrast with Vietnamese equivalents.
Ngày tải lên :
15/04/2013, 15:11
... field of word.
_ Analyzing the culture and linguist of the word “meal” in English and
in Vietnamese equivalents.
_ Comparing the cultural and linguistic analysis of the English word
“meal” and ... formal and well-mannered when they serve tea. The people here favor the
black tea of India and Ceylon served in china cups with handles and matching
saucers. In Britain, tea is made in a pot, using ... introduce
what the English often drink.
3.2.1. Tea
There is a saying that the British like a nice cup of tea in the morning
and a nice cup of tea at night. And at half past seven, their idea...
- 54
- 1K
- 1
Tài liệu Live Red in support of the Heart and Stroke Foundation of Manitoba pdf
Ngày tải lên :
19/02/2014, 03:20
...
community relationships,
ã
help reduce the devastating
effects of Manitoba’s leading
causes of death and disability.
Since 80% of Canadians have
at least one risk factor for heart
disease or stroke, ... Red casual day fundraisers are very popular and simple to
plan.
Dinner, gala or social - Coordinate an evening of dinner and dancing in support
of HSFM. Benefit dinners are great for rewarding ... fight against
heart disease and stroke. No matter how big or small, your efforts will make a
lasting difference in the lives of Manitobans.
“My father died of a heart attack
when he was 64-years-old....
- 57
- 557
- 0
Tài liệu Báo cáo khoa học: Inorganic pyrophosphatase in the roundworm Ascaris and its role in the development and molting process of the larval stage parasites doc
Ngày tải lên :
20/02/2014, 11:20
... (5Â-CCGAGCTCGAGACGTGAAGCGACAATCTCGC
AATCT-3Â) containing an XhoI (Promega) site upstream of
the start codon and an antisense primer (5Â-CAGCCAA
GCTTCTCACTCTTTGATGAAATGCATCT-3Â) con-
taining a HindIII ... proton-
translocating pyrophosphatase; AsPPase, Ascaris suum inorganic
pyrophosphatase; rAsPPase, recombinant A. suum inorganic pyro-
phosphatase; L3, third-stage infective larvae; L4, fourth-stage larvae;
ES, ... Takeharu Miyoshi
1
, Harue Kasuga-Aoki
1
, Takashi Isobe
1
, Takeshi Arakawa
2
,
Yasunobu Matsumoto
3
and Naotoshi Tsuji
1
1
Laboratory of Parasitic Diseases, National Institute of Animal Health,...
- 13
- 691
- 0
Tài liệu Research evaluation of economic, social, and ecological implications of the programme for commercial tree plantations: case study of rubber in the south of Laos PDR pptx
Ngày tải lên :
21/02/2014, 04:20
... areas land
Ministry of Industry and Crafts
mana
g
es industrial land
Ministry of Public Statements and
Culture mana
g
es cultural land
Ministry of National Protection
and Ministry of National ... Lampan Xayalade Research officer, National Land Management Authority
4. Champaphai Khambuasy Office of information and news, Land Management Authority,
Champassak province
5. Somdy Phrommasen ... separate Laos from Thailand. Laos was seen as an enclosed land, a locked land, without a sea
port. This led to the building of the link roads of Indochina.
Indochina in the
colonial era
Laos...
- 135
- 708
- 0
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2