XÁC ĐỊNH đột BIẾN GEN FGFR TRÊN BỆNH NHÂN u NGUYÊN bào THẦN KINH đệm

XÁC ĐỊNH đột BIẾN GEN FGFR TRÊN BỆNH NHÂN u NGUYÊN bào THẦN KINH đệm

XÁC ĐỊNH đột BIẾN GEN FGFR TRÊN BỆNH NHÂN u NGUYÊN bào THẦN KINH đệm
... tài Xác định đột biến genFGFR bệnh nhân u nguyên bào thần kinh đệm thực với mục ti u chính: Bước đ u xác định số đột biến N546K exon 12 R576W exon gen FGFR bệnh nhân u nguyên bào thần kinh đệm ... Đi u trị 1.2 Gen FGFR đột biến gen FGFR gây bệnh u nguyên bào thần kinh đệm 1.2.1 Vị trí c u trúc gen FGFR 1.2.2 Chức năng, chế gây bệnh gen FGFR 11 1.2.3 Đột biến gen FGFR ... hi u quả, việc xác định đột biến gen liên quan đến tính đáp ứng thuốc đóng vai trò quan trọng định thành công phương pháp [14],[15] 1.2 Gen FGFR đột biến gen FGFR gây bệnh u nguyên bào thần kinh...
  • 49
  • 11
  • 0

Xác định đột biến gen ABCC8 trên bệnh nhân cường insulin

Xác định đột biến gen ABCC8 trên bệnh nhân cường insulin
... Bảng 3.2 Kết xác định đột biến gen exon: 5, 6, 27, 28 gen ABCC8 mẫu bệnh nhân cường insulin bệnh nhân HI01 HI02 HI03 Kết Không đột biến g.83201 C>G (Dị hợp tử) Không đột biến Gen ABCC8 gồm 39 ... Trong mẫu bệnh nhân xác định bệnh nhân đột biến Sau kết giải trình tự phát đột biến bệnh nhân mã số labo HI02: GenBank g.83201 C>G Mẫu HI02 Hình 3.5 Kết giải trình tự gen với đột biến g.83201 ... mục tiêu: “Xây dựng quy trình xác định đột biến gen ABCC8 bệnh nhân cường insulin CHƯƠNG TỔNG QUAN 1.1 Bệnh cường insulin bẩm sinh 1.1.1 Giới thiệu chung bệnh cường insulin bẩm sinh Hạ đường huyết...
  • 50
  • 36
  • 0

Xác định đột biến gen FGFR trênbệnh nhân u nguyên bào thần kinh đệm

Xác định đột biến gen FGFR trênbệnh nhân u nguyên bào thần kinh đệm
... Bước đ u xác định số đột biến N546K exon 12 R576W exon gen FGFR bệnh nhân u nguyên bào thần kinh đệm 3 CHƯƠNG TỔNG QUAN 1.1 Đại cương bệnh u nguyên bào thần kinh đệm U nguyên bào thần kinh đệm ... Vì đề tài Xác định đột biến gen FGFR trênbệnh nhân u nguyên bào thần kinh đệm thực với mục ti u chính: Hoàn thiện quy trình xác định đột biến N546K exon 12 R576W exon 13 gen FGFR m u bệnh phẩm ... thuốc đi u trị ung thư [19] 1.1.5.3 Đột biến gen FGFR gây bệnh u nguyên bào thần kinh đệm Đột biến gen FGFR1 Gen FGFR đột biến mã hóa cho protein có khả kích hoạt đường tín hi u xuôi dòng có hay...
  • 46
  • 7
  • 0

Nghiên cứu xác định đột biến và lập bản đồ đột biến gen Dystrophin trên bệnh nhân loạn dưỡng cơ Duchenne Việt Nam (FULL TEXT)

Nghiên cứu xác định đột biến và lập bản đồ đột biến gen Dystrophin trên bệnh nhân loạn dưỡng cơ Duchenne Việt Nam (FULL TEXT)
... Nghiên cứu xác định đột biến lập đồ đột biến gen dystrophin bệnh nhân loạn dƣỡng Duchenne Việt Nam tiến hành với mục tiêu sau: Xác định đột biến xóa đoạn, lặp đoạn đột biến điểm gen dystrophin bệnh ... Những nghiên cứu xác định dạng đột biến gen dystrophin xây dựng đồ đột biến Nghiên cứu Thomas W Prio (2005) cộng xây dựng đồ đột biến gen với 361 bệnh nhân đột biến xóa đoạn (306 bệnh nhân ... nay, nghiên cứu bệnh DMD/BMD giới chia thành hướng chính: Một nghiên cứu áp dụng phương pháp để chẩn đoán xác định dạng đột biến gen dystrophin lập đồ đột biến Hướng nghiên cứu thứ nghiên cứu...
  • 135
  • 64
  • 1

Nghiên cứu xác định đột biến và lập bản đồ đột biến gen dystrophin trên bệnh nhân loạn dưỡng cơ duchenne việt nam (TT)

Nghiên cứu xác định đột biến và lập bản đồ đột biến gen dystrophin trên bệnh nhân loạn dưỡng cơ duchenne việt nam (TT)
... đột biến lặp đoạn chiếm tỉ lệ thấp với 7,7% Xây dựng đồ đột biến gen dystrophin bệnh nhân DMD/BMD Việt Nam Bước đầu xây dựng thành công đồ đột biến gen dystrophin bệnh nhân DMD/BMD Việt Nam Đột ... 79 exon gen dystrophin vòng 24 Nghiên cứu tiến hành số mẫu lớn: 201 bệnh nhân Nghiên cứu tìm số lượng lớn bệnh nhân mang gen đột biến, bao gồm đột biến xóa đoạn, đột biến lặp đoạn, đột biến điểm ... cho bệnh nhân, gia đình Trong nghiên cứu với kết đột biến thu từ bệnh nhân Chúng tiến hành kỹ thuật phù hợp để xác định mang gen bệnh cho người nhà bệnh nhân Với biết trước đột biến, việc xác định...
  • 49
  • 60
  • 0

nghiên cứu xác định đột biến gen f8 gây bệnh hemophilia a (full text)

nghiên cứu xác định đột biến gen f8 gây bệnh hemophilia a (full text)
... xác định đột bi n đảo đoạn intron 22 gen F8 [78] Tên mồi Trình tự ID (mồi xuôi gen F8) ACATACGGTTTAGTCACAAGT IU (mồi ngƣợc gen F8) CCTTTCAACTCCATCTCCAT ED (mồi xuôi gen F8) TCCAGTCACTTAGGCTCAG ... Phát đột biến gen F8 bệnh nhân hemophilia A Việt Nam Bước đầu xây dựng đồ đột biến gen F8 bệnh nhân hemophilia A Việt Nam 3 Chƣơng TỔNG QUAN 1.1 LỊCH SỬ NGHIÊN CỨU BỆNH HEMOPHILIA A Từ thời ... liên quan đột biến gen F8 kiểu hình lâm sàng Đột biến gen F8 yếu tố định quan trọng kiểu hình bệnh hemophilia A [49], [48] Đột biến gặp thƣờng xuyên bệnh nhân hemophilia A thể nặng đột biến đảo...
  • 143
  • 171
  • 0

Luận án tiến sĩ Nghiên cứu xác định đột biến gen F8 gây bệnh hemophilia A (NCS: Lưu Vũ Dũng )

Luận án tiến sĩ Nghiên cứu xác định đột biến gen F8 gây bệnh hemophilia A (NCS: Lưu Vũ Dũng )
... xác định đột bi n đảo đoạn intron 22 gen F8 [78] Tên mồi Trình tự ID (mồi xuôi gen F 8) ACATACGGTTTAGTCACAAGT IU (mồi ngƣợc gen F 8) CCTTTCAACTCCATCTCCAT ED (mồi xuôi gen F 8) TCCAGTCACTTAGGCTCAG ... Phát đột biến gen F8 bệnh nhân hemophilia A Việt Nam Bước đầu xây dựng đồ đột biến gen F8 bệnh nhân hemophilia A Việt Nam 3 Chƣơng TỔNG QUAN 1.1 LỊCH SỬ NGHIÊN CỨU BỆNH HEMOPHILIA A Từ thời ... đột biến gen F8 gây bệnh hemophilia A Hiện nay, hàng năm có nhiều đột biến đƣợc công bố sở liệu HAMSTeRS (Hemophilia A Mutation, Search, Test and Resource Site) trang quản lý thông tin bệnh hemophilia...
  • 143
  • 249
  • 2

Phát hiện đột biến gen COL1A1 trên bệnh nhân tạo xương bất toàn bằng kỹ thuật PCR và giải trình tự gen

Phát hiện đột biến gen COL1A1 trên bệnh nhân tạo xương bất toàn bằng kỹ thuật PCR và giải trình tự gen
... bệnh tạo xương bất toàn thực nhằm mục tiêu: Phát đột biến gen COL1A1 bệnh nhân tạo xương bất toàn kỹ thuật PCR giải trình tự gen 8 CHƯƠNG I TỔNG QUAN 1.1 Lịch sử phát tình hình nghiên cứu bệnh ... 1.4 Các kỹ thuật sinh học phân tử phát đột biến gen COL1A1 Các đột biến gen COL1A1 chủ yếu đột biến điểm kỹ thuật PCR giải trình tự trực tiếp sử dụng để phát đột biến Trong trường hợp đột biến nằm ... collagen týp I (da, xương) Như để phát đột biến gen COL1A1 cần ý tới kỹ thuật là: PCR, RT -PCR giải trình tự gen 1.4.1 Kỹ thuật Polymerase Chain Reaction (PCR) : PCR kỹ thuật nhân DNA ống nghiệm...
  • 68
  • 124
  • 0

NGHIÊN cứu sự đột BIẾN GEN p53 TRÊN BỆNH NHÂN POLYP đại TRỰC TRÀNG tại BỆNH VIỆN VIỆT TIỆP hải PHÒNG

NGHIÊN cứu sự đột BIẾN GEN p53 TRÊN BỆNH NHÂN POLYP đại TRỰC TRÀNG tại BỆNH VIỆN VIỆT TIỆP hải PHÒNG
... cỏc phõn tớch tip theo[6] * Quy trỡnh xỏc nh t bin gen p53 Nhiu nghiờn cu cho thy t bin gen p53 v bt hot gen p53 cú vai trũ ch yu UTTT t bin gen p53 gp > 50% trng hp UTTT, ú hn mt na l t bin im ... mu cũn nh nờn cha thy s t bin trờn a polyp Kt qu t biờn gen p53 nghiờn cu ny cho thy t biờn gen p53 xy trờn polyp na cung v polyp khụng cung vi kớch thc polyp khụng di 10 mm õy l mt s gi ý bnh ... gen p53 cỏc nhúm mụ nghiờn cu Nhn xột: Hỡnh cho thy, 44/46 mu bnh phm khụng cú t bin gen p53 (chim t l 95,6%); phỏt hin c 2/46 mu bnh phm cú t bin gen p53 (chim t l 4,4%) Nhn xột t l t bin gen...
  • 6
  • 84
  • 0

Nghiên cứu phát hiện đột biến gen ATP7B trên bệnh nhân Wilson (FULL TEXT)

Nghiên cứu phát hiện đột biến gen ATP7B trên bệnh nhân Wilson (FULL TEXT)
... tiêu: Phát đột biến gen ATP7B bệnh nhân Wilson Thiết lập đồ đột biến gen ATP7B gây bệnh Wilson bệnh nhân Wilson Việt Nam 3 Chƣơng TỔNG QUAN TÀI LIỆU 1.1 Lịch sử nghiên cứu bệnh Wilson Bệnh Wilson ... trình nghiên cứu toàn diện phát đột biến gen gây bệnh Wilson Việc xác định xác đột biến gen ATP7B bệnh nhân Wilson giúp xác định nguyên nhân gây bệnh, đồng thời tạo tiền đề quan trọng cho việc phát ... chế bệnh sinh dạng đột biến gen ATP7B gây bệnh Wilson 1.8.1 Vị trí, cấu trúc gen ATP7B Năm 1985, Frydman cộng phát gen đột biến bệnh Wilson nằm nhiễm sắc thể 13 [3] Gen mang bệnh khẳng định ATP7B...
  • 132
  • 61
  • 0

Nghiên cứu phát hiện đột biến gen ATP7B trên bệnh nhân wilson

Nghiên cứu phát hiện đột biến gen ATP7B trên bệnh nhân wilson
... trước hôn nhân, giúp ngăn ngừa giảm tỷ lệ mắc bệnh Từ thực tế trên, đề tài "Nghiên cứu phát đột biến gen ATP7B bệnh nhân Wilson" thực với mục tiêu: Phát đột biến gen ATP7B bệnh nhân Wilson Thiết ... chế bệnh sinh dạng đột biến gen ATP7B gây bệnh Wilson 1.8.1 Vị trí, cấu trúc gen ATP7B Năm 1985, Frydman cộng phát gen đột biến bệnh Wilson nằm nhiễm sắc thể 13 [3] Gen mang bệnh khẳng định ATP7B ... exon gen ATP7B Tinh sản phẩm PCR Giải trình tự gen So sánh với GeneBank Xác định đột biến gen ATP7B Bản đồ đột biến gen ATP7B Quy trình xác định đột biến gen ATP7B 49 Chƣơng KẾT QUẢ NGHIÊN CỨU...
  • 133
  • 26
  • 0

Nghiên cứu phát hiện đột biến gen ATP7B trên bệnh nhân wilson (TT)

Nghiên cứu phát hiện đột biến gen ATP7B trên bệnh nhân wilson (TT)
... định đột biến gen bệnh nhân Wilson 48/61 (78,6%) bệnh nhân Wilson Việt Nam có đột biến gen ATP7B, với tổng số 118 phát hiện, 13/61 (21,4%) bệnh nhân không phát thấy đột biến gen ATP7B Đột biến ... công đồ đột biến gen ATP7B bệnh nhân Wilson Việt Nam Bước đầu thiết lập thành công đồ đột biến gen ATP7B bệnh nhân Wilson Việt Nam với 28 dạng đột biến gen phân bố 13 exon gen ATP7B, đột biến vùng ... để phát đột biến điểm 3.3 Kết phát đột biến gen ATP7B Sản phẩm PCR tiếp tục giải trình tự gen để phát đột biến Kết cho thấy có nhiều kiểu gen khác phát bệnh nhân Wilson bao gồm: kiểu gen đột biến...
  • 49
  • 85
  • 0

Nghiên cứu phát hiện đột biến gen ATP7B trên bệnh nhân wilson

Nghiên cứu phát hiện đột biến gen ATP7B trên bệnh nhân wilson
... định đột biến gen bệnh nhân Wilson 48/61 (78,6%) bệnh nhân Wilson Việt Nam có đột biến gen ATP7B, với tổng số 118 phát hiện, 13/61 (21,4%) bệnh nhân không phát thấy đột biến gen ATP7B Đột biến ... công đồ đột biến gen ATP7B bệnh nhân Wilson Việt Nam Bước đầu thiết lập thành công đồ đột biến gen ATP7B bệnh nhân Wilson Việt Nam với 28 dạng đột biến gen phân bố 13 exon gen ATP7B, đột biến vùng ... để phát đột biến điểm 3.3 Kết phát đột biến gen ATP7B Sản phẩm PCR tiếp tục giải trình tự gen để phát đột biến Kết cho thấy có nhiều kiểu gen khác phát bệnh nhân Wilson bao gồm: kiểu gen đột biến...
  • 26
  • 53
  • 0

đánh giá kết quả phẫu thuật u nguyên bào thần kinh đệm ác tính (glioblastoma) tại bệnh viện việt đức

đánh giá kết quả phẫu thuật u nguyên bào thần kinh đệm ác tính (glioblastoma) tại bệnh viện việt đức
... đánh giá kết ph u thuật đi u trị u nguyên bào ác tính (glioblastoma) cần thiết, nhằm phục vụ cho đi u trị tiên lượng bệnh lý Xuất phát từ thực tế tiến hành: Đánh giá kết ph u thuật u não nguyên ... bào thần kinh đệm ác tính (Glioblastoma) bệnh viện Việt Đức nhằm mục ti u sau: Mô tả số đặc điểm lâm sàng, chẩn đoán hình ảnh u nguyên bào thần kinh đệm ác tính (Glioblastoma) Đánh giá kết ph u ... PHÁP NGHIÊN C U 2.1 Đối tƣợng nghiên c u 53 bệnh nhân u não nguyên bào thần kinh đệm ác tính đựợc khám, chẩn đoán, ph u thuật theo dõi Khoa Ph u Thuật Thần Kinh Bệnh viện Việt Đức thời gian từ...
  • 80
  • 701
  • 1

xác định đột biến gen egfr và gen kras quyết định tính đáp ứng thuốc trong điều trị bệnh ung thư phổi không tế bào nhỏ

xác định đột biến gen egfr và gen kras quyết định tính đáp ứng thuốc trong điều trị bệnh ung thư phổi không tế bào nhỏ
... B GIO DC O TO B Y T TRNG I HC Y H NI XáC ĐịNH ĐộT BIếN GEN EGFR GEN KRAS QUYếT ĐịNH TíNH ĐáP ứNG THUốC TRONG ĐIềU TRị BệNH UNG THƯ PHổI KHÔNG Tế BàO NHỏ Chuyờn ngnh : HểA SINH Y HC Mó s : ... 88 4.1 XC NH T L T BIN GEN EGFR V GEN KRAS 88 4.1.1 K thut xỏc nh t bin gen EGFR v KRAS 88 4.1.2 T l t bin gen EGFR 100 4.1.3 T l t bin gen KRAS 109 4.2 NH GI HIU ... cỏc loi t bin gen EGFR nghiờn cu 76 Biu 3.2 T l cỏc loi t bin gen KRAS nghiờn cu 79 Biu 3.3 Phõn b tỡnh trng t bin gen EGFR v KRAS 80 Biu 3.4 T l t bin gen EGFR v gen KRAS nghiờn cu...
  • 193
  • 309
  • 0

Xem thêm

Từ khóa: kết quả xác định đột biến gen tp53 tại vị trí 249ser bằng pcr rflpkết quả xác định đột biến gen tp53 tại vị trí 249ser bằng giải trình tự genxác định đột biến trên gen kras ở bệnh nhân ung thư đại trực tràngnc xac dinh nhung bien doi sinh ly benh ly cua gan va co the cho va nhan gan trong qua trinh ghep va sau ghepsánh tỷ lệ đột biến gen tp53 trên các nhóm nghiên cứutần suất xuất hiện đột biến gen tp53 trên các nhóm nghiên cứusánh với tác giả lê thị thúy và cộng sự thấy tỉ lệ đột biến gen tp53 trên utg là 11 7 khá phù hợp với kết quả của chúng tôingoài ra kết quả cũng cho thấy không có mối liên quan giữa đột biến gen tp53 mức độ biệt hóa tế bào gan trên nhóm utgnghiên cứu sự biến đổi lâm sàng cận lâm sàng trên bệnh nhân u tuyến yên trước và sau xạ phẫu bằng dao gamma quay tại trung tâm y học hạt nhân và ung bướu bệnh viện bạch mai 2007 2010nghiên cứu kết quả điều trị u nguyên bào thận theo phác đồ siop 2001 tại bệnh viện nhi trung ươngxác định mối liên quan giữa nồng độ đường huyết lúc nhập viện hba1c và các đột quỵ của viện sức khỏe quốc gia hoa kỳ trên bệnh nhân nhồi máu não cấptỉ lệ bệnh nhân mang gen tp53 đột biến ở các nhóm nmvr vgm xg thấp nên chúng tôi chỉ tiến hành phân tích mối liên quan của đột biến gen tp53 với các chỉ số sinh hóa huyết học miễn dịch trên nhóm utgxác định tác dụng không mong muốn của thuốc tenecteplase trên bệnh nhân nhồi máu cơ tim cấp và đề xuất biện pháp xử tríbệnh gan do đột biến gen ở trẻ emđột biến gen lặn sẽ biểu hiện trên kiểu hìnhhow much is it gamehow often do youMột số biện pháp luyện phát âm qua dậy thơ cho trẻ mẫu giáo 5 6 tuổiunit entertainmentsophies town pptfarm animalstenses reviewunit animalsunit easterunit habitatsbài giảng môn Tiền lương và Phúc lợi trong Tổ chức Hành chính nhà nước Th.S Phạm Thị Toànunit sportswhat colourwhat have they got pptKhóa luận Giúp học sinh trung học phổ thông vượt qua những sai lầm trong lập luận toán học phần hình họcamur tiger some facts about the animalsan astronaut and an aliencomparison of adjectivesVocabulary for IELTS topic WEEKENDđề cương ôn thi môn kinh tế tri thức
Đăng ký
Đăng nhập