A numerical method for choice of weighting matrices in active controlled structures (p 55 72)

... earthquake First an ideal optimization has been performed A real earthquake record was used as an input signal After the parameters of the performance index have been obtained, the same earthquake ... it was assumed that the noised accelerations of all storeys are available and the control actuators are located at each storey of the structure The dynamics of the measuring instruments and of ... carried out by means of MATLAB and SIMULINK-based programs The numerical simulation showed high efficiency of the proposed method Its main advantage is providing a choice of the index weighting...

a rapid method for estiminating of noise expouse workplace

... Golmohammadi R et al: A Rapid Method for Classification of workplaces based on noise pollution is one of the necessaries for macro programming view of monitoring and controlling of noise According ... in a workplace contain follows: The quality of wall sound absorption The quality of ceiling sound absorption The quality of roof sound absorption Mean of noise sources life The quality of maintenance ... effect on noise aggravation, for each item a modified constant was considered Determining of these constants was based on best multiple regression analysis on SPSS package Total rank of noise pollution...

Báo cáo khoa học: "A Nonparametric Method for Extraction of Candidate Phrasal Terms" docx

... new method for measuring strength of lexical association for candidate phrasal terms based upon the use of Zipfian ranks over a frequency distribution combining n-grams of varying length The method ... study examined the performance of various association metrics on a corpus of 6.7 million words with a cutoff of N=10 The resulting n-gram set had a maximum recall of 2,610 phrasal terms from the ... measures are defined only for bigrams, and not generalize well to phrasal terms of varying length The purpose of this paper is to explore whether the identification of candidate phrasal terms can be...

báo cáo hóa học:" A promising method for identifying cross-cultural differences in patient perspective: the use of Internet-based focus groups for content validation of new Patient Reported Outcome assessments" potx

... Stoop AP, Berg M: Integrating quantitative and qualitative methods in patient care information system evaluation: guidance for the organizational decision maker Methods of Information in Medicine ... that qualitative methods are used to validate conceptual meaning using phenomenological data (an inductive approach) and quantitative validation activities focus on measurement and operational ... Wagner A, Aaronson N, Bech P, et al.: Translating health status questionnaires and evaluating their quality: the IQOLA Project approach International Quality of Life Assessment Journal of Clinical...

Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx

... Island, NY), 0.25 µg of each primer, mM MgC12 in each CD4 reaction and mM MgC12 for CD8 reactions, mM total dNTP's, and 0.5 U of Taq Polymerase For CD4 and CD8 reaction conditions were : 94° for ... or GAPDH The success of the RNA extraction and reverse transcription is determined by quantification of GAPDH mRNA by QC-RT-PCR Each value for quantity of CD4 or CD8 mRNA was standardized according ... (A) CD4, and (B) CD8 The HIV status of each sample is depicted represents HIV positive status, ■ represents HIV negative status, and ▲ ! reepresents unknown status Page of (page number not for...

báo cáo khoa học: " Surface electromyography as a screening method for evaluation of dysphagia and odynophagia" ppt

... be a very timely addition to our evaluation techniques 16 Summary 17 Surface SEMG of swallowing is a simple and reliable method for screening and initial evaluation of dysphagia and odynophagia ... normative database and standard analysis Table 2: Quick reference simplified set of normative data for electric activity obtained by surface EMG for masseter and submental group + platisma during ... oesophageal – of causes for dysphagia or odynophagia Each stage has its mean normal duration and its specific graphic pattern Each pair of electrodes has a third electrode as ground Electrical impedance...

Báo cáo khoa học: " A simple and rapid method for detection of Goose Parvovirus in the field by loop-mediated isothermal amplification" pps

... laboratory and field settings Materials and methods Goslings, tissues, virus, DNA, and standard plasmid DNA templates preparation Goslings, tissues, virus, and standard plasmid DNA templates ... Sichuan Province, China 3Key Laboratory of Animal Diseases and Human Health of Sichuan Province, Yaan 625014, Sichuan Province, China 4College of Animal Sciences, Henan Institute of Science and ... Recommendation of GPV Veterinary Science in China 1962, 8:19-20, (in chinese) Takehara K, Nishio T, Hayashi Y, Kanda J, Sasaki M, Abe N, Hiraizumi M, Saito S, Yamada T, Haritani M: An outbreak of goose...

ASTM D5453 Standard Test Method for Determination of Total Sulfur in Light Hydrocarbons, Spark Ignition Engine Fuel, Diesel Engine Fuel, and Engine Oil by Ultraviolet Fluorescence

... any item mentioned in this standard Users of this standard are expressly advised that determination of the validity of any such patent rights, and the risk of infringement of such rights, are ... 15.2 Bias—The bias of this test method was determined in a 1992 research report (RR:D02-1307)4 by analysis of standard reference materials (SRMs) containing known levels of sulfur in hydrocarbon ... conditions See Test Method D6299 and MNL for further guidance on QC and control charting techniques X2 IMPORTANT FACTORS IN DIRECT INJECTION ANALYSIS OF HYDROCARBONS USING TEST METHOD D5453 (SULFUR) ...

11
1,682
2

Tài liệu Báo cáo khoa học: A facile method for expression and puriﬁcation of the Alzheimer’s disease-associated amyloid b-peptide pdf

... 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, ... 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared in the buffer supplied with the enzyme, and contained Aba, Abb and Abc at 40 nm each, and the start and stop primers Abstart ... SECisolated Ab(1–40) and Ab(M1–40) are at least 97% pure In the lanes containing Ab(1–42) and Ab(M1– 42), there were prominent bands at approximately kDa and faint bands at approximately 14 kDa The...

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-speciﬁc blood vascular and lymphatic endothelial cells of the mouse pdf

... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... functions and intracellular signaling Thus, our system provides an accessible method to examine the endothelial cell biology of the mouse, and will accelerate the molecular and cellular analysis of ... Heart Yolk sac Brain Embryo A chemistry using antibodies against the pan-EC marker, CD31, the lymphatic endothelial and liver sinusoidal endothelial marker Lyve-1 (lymphatic vessel endothelial...

Báo cáo khoa học: A new and efﬁcient method for inhibition of RNA viruses by DNA interference pptx

... and antisense strand (5¢-ATGAGTTTTCCAGAGCAACTT-3¢), and siRNA was synthesized using DNA templates (sense strand, 5¢-AAATGAGTTTTCCAGAGCAACCCTGTCTC-3¢; antisense strand, 5¢-AAGTTGCTCTGGAAAACTCATCCTG ... TTCTGGCCTTC-3¢, and that of s -DNA is 5¢-ATAGGCG GGAATTTTGCATC-3¢ Anti-TMV siRNA was synthesized using the DNA templates 5¢-AAGGGACGAGCA TATGTACACCCTGTCTC-3¢ and 5¢-AAGTGTACATAT GCTCGTCCCCCTGTCTC-3¢ and a Silencer ... evaluated for speciﬁc DNA and RNA concentrations as shown Silencing effect Type of nucleic acid Length Target Localization of target sites (nucleotides) dsDNA as -DNA (ssDNA) s -DNA (ssDNA) siRNA...

Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simpliﬁed enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx

... simplied rate laws for the construction of the Jacobian matrix used for the analysis of stability Enzymatic rate laws and other details of the full kinetic model are given in Appendix S1 Comparing ... and detailed rate laws (hybrid model, values in bold) The heading designates the type of load parameter varied and the range of variation relative to the normal value of the reference state The ... mechanistic and simplied rate laws Calculation of stationary system states calculated with approximate models To check how the inaccuracies of the simplied rate laws translate into inaccuracies of...

USAID Supported a Wide Range of Child and Maternal Health Activities, but Lacked Detailed Spending Data and a Proven Method for Sharing Best Practices pptx

... expertise for child survival and maternal health within USAID Bureau for Asia and the Near East Bureau for Africa Bureau for Latin America and the Caribbean Oversee all country and regional missions ... the Child Survival and Maternal Health account in fiscal years 2004 and 2005 helped fund wide- ranging efforts to lower maternal and child mortality in Africa, Asia and the Near East, and Latin America ... GAO-07-486 Global Health Appendix II: Allocation of Child Survival and Maternal Health Funds within USAID, Fiscal Years 2004 and 2005 Appendix II: Allocation of Child Survival and Maternal Health...

Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot

... the wave dynamics in the near shore area and in the vicinity of coastal structures. It has been found that the numerical model can satisfactorily simulate the wave transformation, ... to wave breaking on a natural beach To verify the accuracy of the numerical model on the simulation of the wave transformation on a natural beach, existing experimental data on the wave dynamics in ... develop a numerical model that can simulate the nearshore wave dynamics, including wave breaking and wave runup, the generation, transport and dissipation of TKE. 2. Governing ...

Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot

... calculation of distributional similarity The method is straightforward: Instead of using the point estimation of v(wi ), we first estimate the distribution of the context profile, p(v(wi )), by Bayesian estimation ... Conclusion ′ This will give: We proposed a Bayesian method for robust distributional word similarities Our method uses a distribution of context profiles obtained by Bayesian d BCb (w1 , w2 ) = ′ ′ K X ... difficult, for example, by just showing examples of similar word lists here Comparing the results of BCb and BC, Table lists the numbers of improved, unchanged, and degraded words in terms of MP@20 for...

Xem thêm

Từ khóa: a modern method for guitar school of tarrega volume 1 pdf a c program for solution of simultaneous linear algebraic equations by gauss elimination method driven evidence based experimental design a new method for interface design used to develop an interface for clinical overview of patient records methylmeter r a quantitative sensitive and bisulfite free method for analysis of dna methylation this is a recommended method for killing salmon see stead and laird handbook of salmon farming 188 a new method for fast purification of recombinant h3 h4 tetramers a powerful method for the analysis of genome destabilizing mechanisms ols or linear least squares is a method for estimating the unknown parameters in a linear regression model this method minimizes the sum of squared vertical distances between the observed responses in the dataset and the resp a—test method for tensile strength and modulus of frp bars ecv as a novel method for doping profiling of polycrystalline silicon saaty t 1977 a scaling method for priorities in hierarchical structures journal of mathematical psychology method for determination of resistance an exact method for characterization of grain shape a modern method for guitar volume 3 pdf a modern method for guitar 123 complete pdf chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Phát hiện xâm nhập dựa trên thuật toán k means Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ