saaty t 1977 a scaling method for priorities in hierarchical structures journal of mathematical psychology
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
Ngày tải lên :
18/02/2014, 17:20
... former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were cloned into the EcoRV site of pZErO-2 (Invitrogen) A XhoI–PvuIIdigested ... tsA5 8T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, ... others), but not by nonendothelial NIH 3T3 cells (data not shown), indicating that the cells maintained the physiological characteristic of acetylated-LDL uptake Lyve-1-positive liver sinusoidal...
- 11
- 873
- 0
Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx
Ngày tải lên :
23/03/2014, 06:20
... models to calculate stationary load characteristics with respect to changes in the consumption of ATP and glutathione (GSH), the two cardinal metabolites that mainly determine the integrity of the ... lactate, pyruvate and phosphate to typical in vivo values creates a stable stationary working state of the system, which was taken as a reference state for the adjustment of the simplified rate ... composed of mechanistic and simplified rate laws Table Ranking of saturation parameters for hepatocyte purine metabolism Average ranking of saturation parameters according to their impact on the dynamic...
- 15
- 456
- 0
a rapid method for estiminating of noise expouse workplace
Ngày tải lên :
05/09/2013, 13:23
... checklist the parameters are inspected that can affect in increasing of noise pollution in a workplace contain follows: The quality of wall sound absorption The quality of ceiling sound absorption The ... contains investigations result that introduces an innovative method for ridding in inspection of workplaces noise without need to the measurement's system The study was based on designing a worksheet ... More than 10 years 5-9 years Less than years Quality of maintenance of equipments Suitable Little suitable Unsuitable Rotation and duration of noise produce noise sources All of shift Half of a...
- 7
- 418
- 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
Ngày tải lên :
18/02/2014, 13:20
... AAGCTGGTG-3¢; Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT ... degeneration and cell loss upon prolonged treatment Importantly, these results indicated that an N-terminal aspartate is not necessary for neurotoxicity An additional advantage of the N-terminal methionine ... using Pfusion DNA polymerase (Finnzymes, Espoo, Finland) according to the manufacturer’s guidelines and using the following primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢;...
- 16
- 691
- 0
Báo cáo khoa học: "A Nonparametric Method for Extraction of Candidate Phrasal Terms" docx
Ngày tải lên :
08/03/2014, 04:22
... occur at least times, 11,384 occur at least 10 times, and only 5,366 occur at least 50 times; in short, the strategy of cutting off the data at a threshold sacrifices a large percent of total recall ... is the term omitted from the n-gram They then calculate mutual expectation as the product of the probability of the n-gram and its normalized expectation This statistic is of interest for two ... terms, but they constitute the exception rather than the rule This state of affairs poses something of a chicken-and-the-egg problem, in that statistical parsing models have to estimate probabilities...
- 9
- 507
- 1
USAID Supported a Wide Range of Child and Maternal Health Activities, but Lacked Detailed Spending Data and a Proven Method for Sharing Best Practices pptx
Ngày tải lên :
28/03/2014, 09:20
... that the database facilitates the sharing of best practices a little or not at all • Web sites USAID supports a number of Web sites that disseminate healthrelated information For example, the ... supporting international research 45 World Health Organization, Pan American Health Organization, Neonatal Health in the Context of Maternal, Newborn and Child Health for the Attainment of the ... regarding evaluation of information dissemination methods USAID also provided information regarding the role that grantees and contractors play in disseminating information Furthermore, the agency...
- 64
- 379
- 0
Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot
Ngày tải lên :
30/03/2014, 21:20
... “complete” in the data, containing 12,827 unique words in total Note that we not deal with ambiguities in the construction of these sets as well as in the calculation of similarities That is, a word ... paper, we apply the Bayesian framework to the calculation of distributional similarity The method is straightforward: Instead of using the point estimation of v(wi ), we first estimate the distribution ... about 57 hours We think this is an acceptable additional cost The limitation of our method is that it cannot be used efficiently with similarity measures other than the Bhattacharyya coefficient, although...
- 10
- 472
- 0
Báo cáo khoa học: "A Unification Method for Disjunctive Feature Descriptions" pot
Ngày tải lên :
31/03/2014, 17:20
... regarded as having a definite part, containing only unconditional conjuncts, and an indefinite part, containing a set of disjunctions The definite part contains no disjunction , and therefore it ... much better than its theoretical worst case time of O(2d) The timings, shown in Table 1, obtained from the experimental parser for systemic grammar also indicate that a dramatic increase in the ... description, which is satisfied by the intersection of the sets of structures that satisfy the two given descriptions The new descriptlon contains all the information that is contained in either of...
- 8
- 361
- 0
a novel method for the synthesis of titania nanotubes using
Ngày tải lên :
05/05/2014, 15:26
... titanium samples are designated in the main text as UAT and SAT, respectively 2.3 Annealing of the materials Fig Experimental setup for anodization of titanium using ultrasonic treatment of nanotubes ... at various time intervals Fig shows that after 120 s of anodization, small pits started to form on the surface of titanium These pits increased in size after 600 s, although still retaining the ... when using magnetic stirring The saturation of current with time indicates the development of repassivation, the saturation of nanotube formation These results are in line with the findings of our...
- 8
- 634
- 0
a novel method for the synthesis of cao nanoparticle
Ngày tải lên :
06/05/2014, 08:55
... enhanced reactivity tension These substances also control both towards the toxicants makes them the potential the reduction rate of metal ions and the materials for the decomposition applications agglomeration ... increasing particle size, a polymer contaminates In recent years, nanocrystalline is often used, either natural or synthetic, with inorganic metal oxides as solid reactive some affinity for metals ... performance for the decomposition of the final temperature (for min); the temperature 2-CEPS was increased at rate of 20 oC/ for 13 Also, detector temperature was 230 oC Experimental Materials...
- 12
- 705
- 0
Báo cáo hóa học: "One Step Nucleic Acid Amplification (OSNA) - a new method for lymph node staging in colorectal carcinomas" docx
Ngày tải lên :
18/06/2014, 16:20
... H&E staining and OSNA None of the LN was HE+/OSNA- and of the 63 LN were HE-/OSNA+, resulting in upstaging of two patients [25] The aspect of upstaging was not the main focus of this investigation ... time the beta-actin value was right on the cut-off level (not shown) which suggests that the RNA concentration contained in the homogenate was very low Sample contained a metastasis restricted to ... et al Journal of Translational Medicine 2010, 8:83 http://www.translational-medicine.com/content/8/1/83 is mandatory, in the OSNA assay amplification directly starts from the lysate and therefore...
- 6
- 535
- 0
Báo cáo sinh học: " A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame" potx
Ngày tải lên :
19/06/2014, 08:20
... sequencing traces Two of the reactions revealed a mixture of G and A at position 1270 and the four other traces clearly indicated that G was dominant at this position; this base was manually identified ... negative control was positive, all PCR reactions in that set were deemed to be contaminated and were discarded Competing interests The author(s) declare that they have no competing interests Authors' ... valid passwords The database and all sequence data are backed up to a secure tapebackup system in a different building three times a week The database will be made available free of charge to interested...
- 9
- 444
- 0
Báo cáo hóa học: " A novel method for neck coordination exercise – a pilot study on persons with chronic non-specific neck pain" docx
Ngày tải lên :
19/06/2014, 08:20
... completed, the subject was instructed to move the ball to another starting position Light emitting diodes indicated the starting position and when the ball was at the center of the plate When the subject ... consecutive rotations (trials) was executed with a short resting interval between trials The subject was instructed to rotate the head with a fast movement as far as possible Prior to each trial the subject ... drafted the manuscript MBJ participated in the design and coordination of the study, the statistical analyses and helped to draft the manuscript MBE participated in the design and coordination of the...
- 10
- 712
- 0
báo cáo hóa học: "A binary method for simple and accurate two-dimensional cursor control from EEG with minimal subject training" potx
Ngày tải lên :
19/06/2014, 08:20
... channel-frequency and head topography plots of Bhattacharyya distances for Subjects A- E using hand movement For all subjects, including the PLS patient (Subject E), the largest Bhattacharyya ... the best channel/bin as that which yielded the smallest minimum value of the distance defined by (2) In this way, we effectively automated the feature analysis by integrating it into the threshold-setting ... threshold-setting program, eliminating the need for the calculation of Bhattacharrya distances, but requiring that all 29 electrodes be used during the threshold-setting task Our modified program chose the...
- 16
- 489
- 0
báo cáo hóa học:" A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame" pdf
Ngày tải lên :
20/06/2014, 04:20
... sequencing traces Two of the reactions revealed a mixture of G and A at position 1270 and the four other traces clearly indicated that G was dominant at this position; this base was manually identified ... negative control was positive, all PCR reactions in that set were deemed to be contaminated and were discarded Competing interests The author(s) declare that they have no competing interests Authors' ... valid passwords The database and all sequence data are backed up to a secure tapebackup system in a different building three times a week The database will be made available free of charge to interested...
- 9
- 442
- 0
báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot
Ngày tải lên :
20/06/2014, 04:20
... participated in the planning of the experiments, data analysis and the preparation of the manuscript MJS supervised the study planning, data analysis and preparation of the manuscript All authors ... different treatments, performed the microscopic analysis and helped with the planning and preparation of the manuscript PIF and AES participated in the cutting and staining of Page of the bone tissue ... a great standard deviation of cell survival was detected The lowest number of surviving osteocytes after treatment, in combination with a low standard deviation, was detected after repeated freeze...
- 4
- 403
- 0
báo cáo hóa học:" A promising method for identifying cross-cultural differences in patient perspective: the use of Internet-based focus groups for content validation of new Patient Reported Outcome assessments" potx
Ngày tải lên :
20/06/2014, 15:20
... 103:566-569 Stoop AP, Berg M: Integrating quantitative and qualitative methods in patient care information system evaluation: guidance for the organizational decision maker Methods of Information in Medicine ... engagement, facilitation and surveying; and 3) the automated management of resulting transcripts and survey data [4] Demonstration that virtual methods provide equivalent qualitative results as both traditional ... quantitative methods, Brookes suggests that qualitative methods are used to validate conceptual meaning using phenomenological data (an inductive approach) and quantitative validation activities...
- 14
- 441
- 0
Báo cáo toán học: " A novel method for crystalline silicon solar cells with low contact resistance and antireflection coating by an oxidized Mg layer" ppt
Ngày tải lên :
20/06/2014, 21:20
... measured for various contact spacings; Rc and RT are plotted as functions of d The intercept at d = is RT = 2Rc, giving the contact resistance To calculate the contact resistance, Mg was evaporated ... sheet resistance beneath the contact Rs (in ohm centimeters) The TLM consists of sets of resistors representing the metal, diffusion, and interfacial layers of a contact [12] The contact resistance ... contact resistance The rest of the wafer was covered with oxidized Mg acting as antireflection coating [ARC] The illuminated currentvoltage characteristics under the global solar spectrum of AM...
- 14
- 648
- 0
Báo cáo hóa học: " Strong convergence of a hybrid method for monotone variational inequalities and fixed point problems" ppt
Ngày tải lên :
20/06/2014, 22:20
... studied in the literature for solving a more general problem that consists of finding a common point that lies in the solution set of a variational inequality and the set of fixed points of a ... 807, Taiwan Authors’ contributions All authors participated in the design of the study and performed the converegnce analysis All authors read and approved the final manuscript Competing interests ... hybrid method for finding a common element of the set of solution of a monotone, Lipschitz-continuous variational inequality problem and the set of common fixed points of an infinite family of Yao...
- 10
- 425
- 0
Báo cáo hóa học: " Research Article A New Method for Least-Squares and Minimax Group-Delay Error Design of Allpass Variable Fractional-Delay Digital Filters" pdf
Ngày tải lên :
21/06/2014, 07:20
... accompanying those of the Deng’s method in Section The related errors in (29) are tabulated in Table It can be observed that both ετ and εθ of the proposed method are smaller than those of the existing method ... better than that with p ∈ [−0.5, 0.5] In this example, the minimax design took eighteen outer iterations, and the respective inner iterations are three and two in the first and second outer iterations, ... used As to the initial coefficient vector a0 , we can adopt the solution in (18) by setting W(ω) = The details of iterative procedures will be described in the next section To evaluate the accuracy...
- 10
- 490
- 0