0
  1. Trang chủ >
  2. Ngoại Ngữ >
  3. Tổng hợp >

Indentation studies on a zr based bulk metallic glass

Indentation studies on a zr based bulk metallic glass

Indentation studies on a zr based bulk metallic glass

... anneal the metallic glass To investigate the effect of quasi-static deformation on nanocrystallization behaviour in the shear bands, they conducted nanoindentation experiments on metallic glass Zr5 2.5Cu17.9Ni14.6Al10Ti5 ... 2.6.3 Indentation Investigation on Metallic Glasses Indentation may introduce a constrained or stable stress field and thus provides a way to characterize multiaxial plastic deformation of BMGs at ... of bulk metallic glasses Keywords: Bulk metallic glass, Mechanical properties, Hardness, Shear band, Spherical indentation, Nanoindentation vi List of Tables 2-1 Alloy systems, years and maximum...
  • 119
  • 390
  • 0
Some studies on a probabilistic framework for finding object-oriented information in unstructured data

Some studies on a probabilistic framework for finding object-oriented information in unstructured data

... framework for finding object-oriented information in unstructured data Two above solutions can be plausible for solving object search problem Yet, the Information Extraction based solution has ... they also have some shortcomings Information Extraction based solution has low scalability and low adaptability while Text Information Retrieval based solution has high scalability but low adaptability ... VIETNAM NATIONAL UNIVERSITY, HANOI COLLEGE OF TECHNOLOGY TRAN NAM KHANH SOME STUDIES ON A PROBABILISTIC FRAMEWORK FOR FINDING OBJECT-ORIENTED INFORMATION IN UNSTRUCTURED DATA UNDERGRADUATE THESIS...
  • 51
  • 393
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] The surE gene duplicated ... phosphate concentrations are high 5862 Materials and methods Cloning and purification of St SurE The SurE gene was PCR amplified from Salmonella enterica Typhimurum strain IFO12529 genomic DNA as...
  • 10
  • 553
  • 0
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

... Part of a two-dimensional 1H,13C HSQC spectrum of the O-specific polysaccharide (OPS) of Citrobacter braakii PCM 1531 One-dimensional 1H and 13C NMR spectra are displayed along the horizontal and ... immunodiffusion of anti (Citrobacter braakii PCM 1531) serum (A) and anti- (Citrobacter PCM 1487) serum (B) with lipopolysaccharide (LPS)-I (well 1) and LPS-II (well 2) of C braakii PCM 1531, and LPS of Citrobacter ... inhibition of passive haemagglutination, SDS/ PAGE and immunoblotting using O-antisera against C braakii PCM 1531 and PCM 1487 In double immunodiffusion (Fig 4), the LPS of C braakii PCM 1531 and PCM...
  • 7
  • 478
  • 0
Genetic studies on a soil streptomyces sp  that produces an antifungal compoud

Genetic studies on a soil streptomyces sp that produces an antifungal compoud

... to a variety of fungal, bacterial, protozoal and viral diseases Species of Candida, Coccidioides, Histoplasma, and Aspergillus are important causative agents Of these, Candida species, especially ... can be isolated separately and are designated as type II FAS enzymes In contrast, mammalian FAS are large multifunctional proteins and are designated as type I FAS enzymes Various intermediate ... at a ‘transition stage’ as biomass changes from the quasi-exponential toward the stationary phase It has been suggested that such timing of antibiotic production and differentiation is adaptive...
  • 232
  • 455
  • 0
Constitutive behavior of bulk metallic glass composites at ambient and high temperatures

Constitutive behavior of bulk metallic glass composites at ambient and high temperatures

... Background and literature review 2.1 Metallic glass and glass forming ability 2.2 Mechanical properties of Bulk Metallic glass and Bulk metallic glass composites 2.3 Applications ... models to describe the large deformation behavior of Bulk Metallic Glass (BMG) composites at room and high homologous temperatures, as well as at different strain rates Firstly, a macroscopic theoretical ... intermediate temperatures 200 380 °K the ASRS is negative, deformation proceeds by shear banding and there are fluctuations in the 14      progression of deformation; (III) at elevated temperatures, ...
  • 171
  • 318
  • 0
Strength, plasticity, and fracture of bulk metallic glasses

Strength, plasticity, and fracture of bulk metallic glasses

... and H J Gao An instability index of shear band for plasticity in metallic glasses Acta Materialia, 2009, 57: 1367 Z Han and Y Li Cooperative shear and catastrophic fracture of bulk metallic glasses ... updated this map in terms of bulk metallic glass instead of amorphous ribbons In this thesis, we only focus on the region of inhomogeneous deformation of bulk metallic glasses Before describing ... concept of SBI is of fundamental importance for a shift of paradigm in the future study of MGs The fourth contribution of this work is to uncover the mechanisms of the plastic serrated flow and fracture...
  • 159
  • 246
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article 60 GHz Indoor Propagation Studies for Wireless Communications Based on a Ray-Tracing Method" docx

... [10] N Moraitis and P Constantinou, Indoor channel measurements and characterization at 60 GHz for wireless local area network applications,” IEEE Transactions on Antennas and Propagation, vol ... Selected Areas in Communications, vol 20, no 3, pp 620–630, 2002 [3] T Manabe, Y Miura, and T Ihara, “Effects of antenna directivity and polarization on indoor multipath propagation characteristics at ... RMS delay spread MODELING OF ROOM AND HALLWAY For our 60 GHz propagation studies, of particular interest was the effect of wall configuration on the channel parameters and the fading statistics...
  • 6
  • 274
  • 0
Consolidation Chareteristics based on a direct analytical solution of the Terzaghi Theory

Consolidation Chareteristics based on a direct analytical solution of the Terzaghi Theory

... coefficient of consolidation and end of primary settlement based on a direct solution of the Terzaghi theory This new method determines the coefficient of consolidation utilizing the entire range of consolidation ... study confirms that the identification of the experimental range of primary consolidation that corresponds to the Terzaghi theory is of primary importance for a realistic determination of the coefficient ... ranges from 12% to 66% THE PROPOSED METHOD The actual theoretical one-dimensional consolidation relationship between average degree of consolidation U and the time factor T obtained from the Terzaghi...
  • 9
  • 402
  • 0
Fuel economy improvement based on a many-gear shifting strategy

Fuel economy improvement based on a many-gear shifting strategy

... to make this approach applicable to conventional transmissions, a many-gear transmission concept has been established Fuel economy and gear shifting effects Many approaches are known as feasible ... Lechner G et al, Automotive Transmission, Springer publication,1994 Notations and abbreviations AMT Automated Manual Transmission AT Automatic Transmission CVT Continuously Variable Transmission EFCC ... gear shifting strategy for manual transmissions, The 3rd International Conference on Mechatronics and Information Technology , ICMIT’ China, 2005 [7] Montazeri M and Asadi M Optimisation of AMT...
  • 14
  • 475
  • 1
Plasmonic Green Nanolaser Based on a Metal SemiconductorStructure

Plasmonic Green Nanolaser Based on a Metal SemiconductorStructure

... optical data storage, ultrafast optical communication, as well as biological/chemical sensing and imaging in the visible and infrared spectral regions ) Figure Anisotropic laser emission (a) Variation ... and preparation procedures, optical measurement setups, numerical simulation method, as well as additional experimental data This material is available free of charge via the Internet at http://pubs ... near future The implementation of this type of InGaN plasmonic nanolaser operating well below the diffraction limit can find a wide range of applications for optical integrated circuits, ultrahigh-density...
  • 5
  • 492
  • 0
Tài liệu Báo cáo khoa học: Modeling of tRNA-assisted mechanism of Arg activation based on a structure of Arg-tRNA synthetase, tRNA, and an ATP analog (ANP) ppt

Tài liệu Báo cáo khoa học: Modeling of tRNA-assisted mechanism of Arg activation based on a structure of Arg-tRNA synthetase, tRNA, and an ATP analog (ANP) ppt

... crystals of the ternary complex of S cerevisiae ArgRS, Arg and tRNAArgICG grow contains tRNA, l -Arg, ATP and Mg2+ at sufficient concentrations for the aminoacylation reaction, and (NH4)2SO4 and ... no means in a conformation that is fit to activate The fact that kcat and Km for tRNAArg in the aminoacylation reaction not change in the Asn106 fi Ala, Gln111 fi Ala and Phe109 fi Ala mutants of S ... codon usages for AGA and AGG codons are 19 and 34, respectively, and they amount to 98% among six codons for Arg The D-loops of isoacceptor tRNAUCU and tRNACCU contain nine (AGCAGGAC20aA) and...
  • 17
  • 512
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Dialog Navigator : A Spoken Dialog Q-A System based on Large Text Knowledge Base" docx

... 2002 Dialog Navigator : A Question Answering System based on Large Text Knowledge Base In Proceedings of COLING 2002, pages 460–466 Sadao Kurohashi and Makoto Nagao 1994 A syntactic analysis ... recognition After that, the system retrieves relevant texts in the text knowledge base using each candidate, and makes confirmation based on significance for retrieval Confidence in recognition We ... long Japanese sentences based on the detection of conjunctive structures Computational Linguistics, 20(4) A Lee, T Kawahara, and K Shikano 2001 Julius – an open source real-time large vocabulary...
  • 4
  • 509
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Generating with a Grammar Based on Tree Descriptions: a Constraint-Based Approach" pptx

... anchor, all leaves of fragments are negative, and internal node variables are neutral This guarantees that in a saturated model, tree fragments that belong to the denotation of distinct tree descriptions ... propositions are instantiated A free variable is instantiated as follows: each free variable labels a syntactic node variable and is unied with the label of any node variable identied with For ... overt quantication over the missing agent position (such as with a variable over the complement verb semantics) And a grammar with a rich lexical semantics might for instance associate the semantics...
  • 8
  • 397
  • 0
Impact of chronic disease on quality of life among the elderly in the state of São Paulo, Brazil: a population-based study pptx

Impact of chronic disease on quality of life among the elderly in the state of São Paulo, Brazil: a population-based study pptx

... better consideration in health care programs for the elderly, Lima et al • Chronic diseases and quality of life among elderly in Brazil such as the negative impact on the vitality and general health ... Lima et al • Chronic diseases and quality of life among elderly in Brazil Noncommunicable chronic diseases are conditions that tend to stay with individuals for a long period of time These diseases ... Lima et al • Chronic diseases and quality of life among elderly in Brazil TABLE 2b Mean scores and mean differences of SF-36® scales according to the presence or absence of chronic conditions among...
  • 8
  • 701
  • 0

Xem thêm

Từ khóa: about the use of computational fluid dynamics cfd in the framework of physical limnological studies on a great lakecheckpointing service on a java based grid platformstudies on a src family proteinmicrostructural dependence of mechanical properties in bulk metallic glasses and their compositesstudies of therapeutic strategies for atrial fibrillation based on a biophysical model of the human atriawaiver of in vivo bioavailability and bioequivalence studies for immediate release solid oral dosage forms based on a biopharmaceutics classification system guidance 2000two case studies based on a wireless biometric badgevaluing a stock based on dividendshow to value a stock based on dividendsdhoka based on a true love story mp3 song free downloaddetermine a mapping based on the combined fuzzy rule base17  match one of two alternatives based on a conditionconstructing a model based on steps 1 3neuro knowledge model based on a pid controller to automatic steering of shipsfinger vein image restoration based on a biological optical modelBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ