0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Characterization of zebrafish vitellogenin gene family for potential development of receptor mediated gene transfer method 2

Characterization of zebrafish vitellogenin gene family for potential development of receptor mediated gene transfer method 5

Characterization of zebrafish vitellogenin gene family for potential development of receptor mediated gene transfer method 5

... heterogenicity of vtg gene family and expressions of multiple vtg genes were investigated using a model fish, the zebrafish (Danio rerio) The study of vtg genes provides valuable information for further ... Red tilapia (Oreochromis mossambica) was used to explore the potential of using Vtgs as DNA carriers for development of a novel method for producing transgenic fish Preliminary experiments showed ... investigation of the expression sites of vtg genes challenge the traditional belief that liver is the only organ for Vtg synthesis in oviparous vertebrates The preliminary studies on receptor- mediated gene...
  • 4
  • 137
  • 0
Characterization of zebrafish vitellogenin gene family for potential development of receptor mediated gene transfer method 4

Characterization of zebrafish vitellogenin gene family for potential development of receptor mediated gene transfer method 4

... Receptor- mediated gene transfer 24 hr, DNA~Vtg-pLys 144 24 hr, DNA~Vtg-pLys 144 24 hr, DNA 24 hr, DNA 24 hr, DNA 48 hr, DNA~Vtg-pLys 144 48 hr, DNA~Vtg-pLys 144 48 hr, DNA 48 hr, DNA 60 55 % of total ... radioactivity % of recovered of whole fish 50 45 40 35 30 25 20 15 10 24 48 ovary 24 48 liver 24 48 gut 24 gill 48 24 48 heart 24 48 spleen 24 48 kidney 24 48 others remains Fig 4- 6 Relative radioactivities ... 211 nm was measured for each elute For modification of pLys 144 by SPDP at a molar ratio of pLys 144 to SPDP of 1:2, 30 µl of SPDP (20 nmol/µl) was mixed with 150 µl of pLys 144 (2 nmol/µl) and the...
  • 47
  • 230
  • 0
Characterization of zebrafish vitellogenin gene family for potential development of receptor mediated gene transfer method 3

Characterization of zebrafish vitellogenin gene family for potential development of receptor mediated gene transfer method 3

... Chapter Expression of vtgs 3. 3 .3 Tissue localization of vtg mRNAs 3. 3 .3. 1 Expression of vtgs in the liver of female fish and E2 treated male fish 3. 3 .3. 1.1 Morphological observations of H&E stained ... of vtgs sizes of the amplified products were the same as estimated from vtg cDNA sequences, i.e., 1 73 bp for vtg1, 190 bp for vtg2 and 130 bp for vtg3 (Fig 3- 3B,D,F) 3. 3.2.1.2 Determination of ... 11 .3 Female E2 treated 636 .1 30 .0 9.6 1.1 1.0 3. 5 3. 0 9.7 Fold induction 5.4 4.4 -0.5 0.5 0.5 1.5 1.6 -0.1 Control 6.0 1.7 10.7 5.5 0.6 3. 6 1 .3 13. 7 Male E2 treated 731 .4 42.5 15.5 1.9 0.7 3. 2 3. 4...
  • 52
  • 272
  • 0
Characterization of zebrafish vitellogenin gene family for potential development of receptor mediated gene transfer method 2

Characterization of zebrafish vitellogenin gene family for potential development of receptor mediated gene transfer method 2

... full-length cDNA sequences of vtg1-7 A8** A17 A 22 A30 A67 A80 A87 A119 A 126 A139 A183 A186 A1 92 A193 A 220 A 227 A248 A250 A2 52 A253 A256 A257 A259 A269 A2 72 A290 A295 A296 A300 A306 A3 42 A349 A368 A371 ... (24 0) 44% (28 8) 43% (23 5) 47% (24 7) 40% ( 325 ) 49% (22 2) 39% (316) 48% (26 5) 40% (20 8) 47% (25 9) 43% (24 9) 46% ( 328 ) 52% (20 0) 43% (20 5) 43% (21 8) 46% (25 2) 43% (24 4) 48% (21 6) 41% (25 6) 53% (21 7) ... 47% (24 4) 43% (318) 78% (22 2) 42% (318) 80% (26 1) 44% (20 6) 44% (25 6) 78% (24 4) 46% ( 323 ) 79% (20 0) 42% (20 7) 79% (21 8) 99% (25 3) 45% (24 4) 44% (21 7) 43% (25 6) 81% (22 1) 88% (28 9) 98% (26 5) 43%...
  • 58
  • 363
  • 0
Characterization of zebrafish vitellogenin gene family for potential development of receptor mediated gene transfer method 1

Characterization of zebrafish vitellogenin gene family for potential development of receptor mediated gene transfer method 1

... Chapter General Introduction 1. 1 Oogenesis and vitellogenesis 1. 1 .1 Oogenesis The development of an egg is known as oogenesis, which can be divided into different phases including 1) proliferation of ... harness of this gene transfer method will rely on the improvements of its reproducibility and the foreign gene integration rate 18 Chapter General Introduction D Particle bombardment Gene transfer ... levels in the liver of teleost fish (Mommsen and Walsh, 19 88) 1. 2 Vitellogenin 1. 2 .1 Vitellogenin proteins The term vitellogenin was first used to refer to a serum form of a yolk protein precursor...
  • 26
  • 337
  • 0
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

... alkylation leading to a depletion of mtDNA in intact cells (Fig 1) Here we report the synthesis and characterization of a novel mitochondria- targeted alkylating reagent and show that it alkylates ... One approach to increase the duration of PNA binding to DNA is to conjugate it to a DNAalkylating reagent so that the PNA becomes covalently bound to its target sequence To this a DNA alkylating ... molecular mass markers be further accumulated within the mitochondria due to the mitochondrial membrane potential [11] From the known plasma and mitochondrial membrane potentials and the cell and mitochondrial...
  • 10
  • 638
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Epitope characterization of the protective monoclonal antibody VN04-2 shows broadly neutralizing activity against highly pathogenic H5N1" ppt

... antibody binding and the utility of the antibody for protection against recently circulating H5N1 viruses The mAb VN04-2 was raised against the HA of A/Vietnam/ 1203/04, therefore to select the ... lack of antibody binding [12] Here we evaluated binding of VN04-2 to a variety of H5 hemagglutinins (HA) independent of the HI assay, to determine the actual effects mutations in this region of the ... indicated that the proteins were correctly folded (data not shown) To examine the ability of the humanized antibody VN042 to bind to the selected HAs, ELISA was performed Figure shows the level of binding...
  • 4
  • 343
  • 0
Pathomechanistic characterization of DMT1 mediated manganese cytotoxicity implications in neurodegeneration

Pathomechanistic characterization of DMT1 mediated manganese cytotoxicity implications in neurodegeneration

... expressed in almost every population of cells in the brain, these results indicate the importance of DMT1 in mediating iron transport in the brain In addition, as an example of DMT1 mutation in human, ... expression of DMT1 was also found in the astrocytic end feet, suggesting the involvement of DMT1 in iron uptake from the endothelial cells lining of the BBB (Wang, Ong et al 2001) Interestingly, ... basal ganglia of non-human primate also showed robust DMT1 staining The regions with extensive DMT1 staining were also co-observed with iron staining examined using Turnbull’s iron staining assay...
  • 233
  • 435
  • 0
Identification and characterization of a candida albicans alpha 1,2 mannosyltransferase CaMNN5 that suppresses the iron dependent growth defect of saccharomyces cerevisiae aft1 delta mutant

Identification and characterization of a candida albicans alpha 1,2 mannosyltransferase CaMNN5 that suppresses the iron dependent growth defect of saccharomyces cerevisiae aft1 delta mutant

... 5′ GTGATTACGAAAAAGCATTTTGTGAAAAGGTTTTACC 3′ 5′ GGTAAAACCTTTTCACAAAATGCTTTTTCGTAATCAC 3′ E58 8A: 5′ GAAATGGTTGAAGGCAACAGCTGAAATTCCTACAGTAG 3′ 5′ CTACTGTAGGAATTTCAGCTGTTGCCTTCAACCATTTC 3′ The following ... CATTACTTGTTTGAAGGAATTTTGTGAAGCTGTTGTCTTCG 3' M2-R: 5' CGAAGACAACAGCTTCACAAAATTCCTTCAAACAAGTAATG 3' M3-F: 5' CATTACTTGTTTGAAGGAAACTGCAGAAGCTGTTGTCTTCG 3' M3-R: 5' CGAAGACAACAGCTTCTGCAGTTTCCTTCAAACAAGTAATG ... GGATCCCGGCGAATGATTATGAGA 3' CGCCCAAAGAGGTTTATG 3' ScAFT1 deletion AFT1 ABf: 5' TGAAGTATAAACCGCTAC 3' 28 Chapter Materials and methods AFT1 ABr: AFT1 CDf: AFT1 CDr: 5' GGATCCAGATGAATCAAATTGTTT 3' 5' GGATCCGGAAGAGTGGGATCGG...
  • 124
  • 400
  • 0
Tài liệu Báo cáo khoa học: Role of receptor-mediated endocytosis, endosomal acidification and cathepsin D in cholera toxin cytotoxicity pdf

Tài liệu Báo cáo khoa học: Role of receptor-mediated endocytosis, endosomal acidification and cathepsin D in cholera toxin cytotoxicity pdf

... chloroquine and monensin interfered with the ATP-dependent intraendosomal degradation of internalized radioactive CT [6] Recently, we have identified an endosomal aspartic acid protease, cathepsin D, ... action of cholera toxin and cathepsin D T El Hage et al min) increased two-fold in endosomes isolated from CT-injected rats (closed squares), but this was not observed for CT-B-injected (closed diamonds) ... CT action A B Role of endosomal acidification and cathepsin D in CT action Fig CT-mediated recruitment of ARF-6 and ADP-ribosylation of Gsa in hepatic endosomes (A) Rat liver endosomal (EN), plasma...
  • 16
  • 536
  • 0
Tài liệu Báo cáo khoa học: Characterization of the promoter for the mouse a3 integrin gene Involvement of the Ets-family of transcription factors in the promoter activity doc

Tài liệu Báo cáo khoa học: Characterization of the promoter for the mouse a3 integrin gene Involvement of the Ets-family of transcription factors in the promoter activity doc

... within )260/)119, we Ó FEBS 2002 Integrin a3 gene promoter (Eur J Biochem 269) 4529 Fig Effects of mutations in the Ets- and GATA-binding sites and the E-box of the mouse a3 integrin gene on promoter ... assay (EMSA) using the Ets consensus site at )133 As the involvement of the Ets consensus binding site at )133 in the promoter activity of the mouse a3 integrin gene was suggested by the luciferase ... regulation for the integrin a3 subunit is one of crucial issues to be resolved in cancer biology We previously reported the structures of the mouse a3 integrin subunit gene including the exon/intron...
  • 9
  • 562
  • 0
Molecular characterization and developmental expression patterns of the zebrafish twist gene family

Molecular characterization and developmental expression patterns of the zebrafish twist gene family

... pattern with other species 83 4.5.1 Zebrafish twist1 a and twist1 b genes 83 4.5.2 Zebrafish twist2 85 4.5.3 Zebrafish twist3 86 4.6 Shared and unique expression sites of the zebrafish twist genes 86 ... proteins generated by the neighbor-joining method Figure 3.6: Gene structure of twist1 a, twist1 b, twist2 and twist3 Figure 3.7: RT-PCR of zebrafish twist genes Figure 3.8: Expression of zebrafish twist ... medaka, and human twist genes showed that the zebrafish twist1 a and twist1 b are coparalogs and co-orthologs of human TWIST1 Furthermore, zebrafish twist1 a and twist1 b are orthologous to medaka twist1 a...
  • 115
  • 260
  • 0
Báo cáo y học:

Báo cáo y học: "Characterization of Human Erythrocytes as Potential Carrier for Pravastatin: An In Vitro Study"

... of pravastatin in human erythrocytes The current work studies effect of time, temperature as well as drug concentration on the process of pravastatin loading into human erythrocytes by endocytosis ... characterization of pravastatin loaded erythrocytes Hematological Indices To determine the effect of loading process on erythrocytes, normal erythrocytes, erythrocytes suspended in PBS, and pravastatin-loaded ... Koitabashi Y, Kumai T, Matsumoto N, Watanabe M, Sekine S, Yanagida Y, Kobayashi S Orange juice increased the bioavailability of pravastatin, 3-hydroxy-3-methylglutaryl CoA reductase inhibitor, in...
  • 9
  • 829
  • 0
Biochemical characterization of thermophilic lignocellulose degrading enzymes and their potential for biomass bioprocessing

Biochemical characterization of thermophilic lignocellulose degrading enzymes and their potential for biomass bioprocessing

... breakdown of lignocellulosic biomass for the establishment of a robust and cost-efficient process for production of cellulosic ethanol Acknowledgements Financial support by the Center for Bioprocessing ... thermophilic consortia for cellulase and xylanase production [7, 27] These reports, however, lack information on the biochemical and kinetic properties of the secreted enzymes Such information may be ... understanding of the lignocellulose biodegradation in relation to the enzyme system produced by the microbial community The focus of this work was on the characterization of cellulose- and xylan-degrading...
  • 14
  • 525
  • 0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

... Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC -3 ; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and ... Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* Mutation of the Oct-1 element with the sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) centered at )1 23 within ... Prm3aab; pGL3b:Prm3aab & pGL3e:Prm3aab (Primer Kin160; 5¢-dGAGAGGTACCGCAAATCTTCTCTCGCC TCC -3 , corresponding to NTs )106 to )86) (8) Prm3aaa; pGL3b:Prm3aaa & pGL3e:Prm3aaa (Primer Kin161, 5¢-dGAGAGGTACCGCAGCATCGGCCTGATG...
  • 18
  • 509
  • 0

Xem thêm

Từ khóa: application of full length cdna resources to gain of function technology for characterization of plant gene function— characterization of zebrafish udu mutant positional cloning and functional study of udu genean exact method for characterization of grain shapec 1 physical characterization of the set up for an enantioselective synthesisevolution of molecular techniques for the characterization of mrsa clonespotential mechanisms for the development of an epidemicphenotype anthocyanin indexes and flavonoids in accessions from a close relative of soybean neonotonia wightii wright amp arn j a lackey in the u s germplasm collection for potential use as a health foragechecklist for phenotypic characterization of cattlechecklist for phenotypic characterization of sheep and goatschecklist for phenotypic characterization of chickenschecklist for phenotypic characterization of pigsmesoscopic model for dynamic simulations and structural characterization of cnt materialsthe use of various types of nmr and ir spectroscopy for structural characterization of chitin and chitosancharacterization of long term creep fatigue behavior for glass fiber reinforced polypropylenethe roles of receptor associated protein rap as a molecular chaperone for members of the ldl receptor familyBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ