Synthesis of zr beta zeolite in fluoride medium and its applications in catalytic liquid phase reactions

... Al-containing Zr- beta zeolite 37 2.1.4 Synthesis of Ti -beta zeolite 37 2.1.5 Synthesis of Al- and Sn -beta zeolites 38 2.1.6 Synthesis of Al -beta sample in basic medium 38 2.1.7 Synthesis of Zr- SBA-15 ... zeolite beta in fluoride medium 1.2.3 Incorporation of other metal elements into zeolite beta 1.2.4 Synthesis mechanism of zeolite beta 1.2.5 Structure of zeolite beta 1.3 Modification of zeolite ... production of fine chemicals in liquid phase reactions The objective of this study is to study the synthesis and characterization of Al-free Zr- beta in fluoride medium, and to apply the as-made Zr- beta...

Báo cáo hóa học: " Controllable synthesis of flake-like Al-doped ZnO nanostructures and its application in inverted organic solar cells" doc

... Al concentrations in a solution of 0.025 M zinc nitrate [Zn(NO3)2·6H2O] and hexamethylenetetramine (HMT), we obtained ultrathin flake-like AZO nanostructures of high s and distinct morphology Moreover, ... 0.337, and a PCE of 1.04% With doping and mM Al concentrations, the J SC of devices increases to 10.26 and 11.08 mA cm -2 , and the PCE increases to 1.26% and 1.44%, respectively With increasing ... suggests that electrons can be injected from the LUMO of P3HT into the LUMO of ZnO In this study, upon the Al-doping treatment, it is interesting to observe that the ultrathin and disperse AZO NF arrays...

Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deﬁciency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf

... to a major change in the supramolecular organization of the peripheral antenna The absence of LHCII oligomers in these strains leads to the accumulation of LHCII monomers that presumably transfer ... in the pmf revertant strains (Fig 2) As observed in most PSII mutants identiﬁed so far in C reinhardtii [1], the strong decrease of apoCP47 and apoCP43 was accompanied by a similar decrease in ... the same segregation, as that observed for PSII activity and PG content Translation initiation of the psbA mRNA is not affected in the mf2 strain The dramatic decrease in D1 synthesis in mf1 and...

báo cáo hóa học:" Minireview: Transaminases for the synthesis of enantiopure beta-amino acids" doc

... potential for the synthesis of optically pure βamino acids These pyridoxal 5’-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis ... Advantages in the use of TAs lie in mostly low-cost substrates, no necessity for external cofactor recycling and the enzymes’ high enantioselectivity and reaction rate For the synthesis of enantiopure ... of Lys258 then acts as a catalyst for the 1,3-prototropic shift to form the ketimine The ketimine is hydrolyzed to yield the keto acid and PMP The following second half reaction consists of the...

Characterization of candida albicans cyclase associated protein CAP1 and its roles in morphogenesis g actin associates with the adenylyl cyclase cyr1 through cap1 and regulates cAMP synthesis in candida albicans hyphal morphogenesis

... CHARACTERIZATION OF CANDIDA ALBICANS CYCLASE- ASSOCIATED PROTEIN CAP1 AND ITS ROLES IN MORPHOGENESIS — G- actin Assoicates with the Adenylyl Cyclase Cyr1 through Cap1 and Regulates cAMP Synthesis ... resulting in impaired response to the hyphal- inducing signals Furthermore, the finding that the purified Cyr1 /Cap1/ actin complex can increase cAMP synthesis in response to hyphal- inducing molecules ... activate cAMP synthesis by binding to the LRR domain of Cyr1, suggesting that Ras1 may not be essential for hyphal induction In some conditions, the G protein- coupled receptor Gpr1 and the G protein...

Hydraulic modeling of open channel flows over an arbitrary 3-d surface and its applications in amenity hydraulic engineering

... contents of the following published and/ or accepted journal and conference papers: Anh T N and Hosoda T.: Depth-Averaged model of open channel flows over an arbitrary 3D surface and its applications ... predicted the water surface profile and velocity distribution well in simple channels, and the predictions of the model in main channel of compound meandering channel were also in general agreement ... analysis of water surface profile Journal of Hydraulic Engineering, ASCE (accepted on May 12, 2006) Anh T N and Hosoda T.: Oscillation induced by the centrifugal force in open channel flows over...

Báo cáo khoa học: Identiﬁcation and characterization of 1-Cys peroxiredoxin from Sulfolobus solfataricus and its involvement in the response to oxidative stress pdf

... thioredoxins were found In this study we examined the involvement of the peroxiredoxin Bcp2 in oxidative stress in the hyperthermophilic aerobic archaeon Sulfolobus solfataricus Furthermore, ... clarified in detail and could play a key role in the detoxification processes In this study we examined the role of Bcp2 in order to increase the knowledge of the enzymatic activity involved in the oxidative ... Furthermore, we report the cloning, the expression and the characterization of the recombinant protein rBcp2 in order to shed light on its role in the detoxification process and on its catalytic mechanism...

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identiﬁed and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains and a single KH domain similar ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1 (ANKHD1) variants,...

synthesis of hematite (r-fe2o3) nanorods diameter-size and shape effects on their

... the concentration of HCHO gas, which is certainly scientifically and technically interesting Conclusions In summary, we have described in this paper the shapecontrolled synthesis of hematite (R-Fe2O3) ... the formation of porous R-Fe2O3 and reminiscent of the orientation-ordered nanostructures for R-Fe2O3 in air conditions based on the combined analysis of DrTGA and TEM results Additionally, it ... provides not only the first example of investigating the magnetic property evolution of nanorods/ nanowire diameters and porosity, but also the first example of the fabrication of hematite nanostructure...

Báo cáo khoa học: Huntington’s disease: roles of huntingtin-interacting protein 1 (HIP-1) and its molecular partner HIPPI in the regulation of apoptosis and transcription pptx

... Htt-interacting protein HIP -1 and its molecular partner HIPPI in the regulation of apoptosis and transcription, the two processes that are altered in HD [7,8] HIP -1 – its interacting partners and ... Conclusions HIP -1 and its interacting partner HIPPI together induce apoptosis by the intrinsic and extrinsic pathways Homer 1c, an interactor of HIPPI, and the wild-type N-terminal Htt, which interacts ... apoptosis induction The effect of HIP -1 may depend not only on the amount of the interacting proteins but also on the afﬁnities of interacting proteins The uncreased expression of caspase -1 observed in...

Báo cáo khoa học: Kinetic studies on endo-b-galactosidase by a novel colorimetric assay and synthesis of N -acetyllactosamine-repeating oligosaccharide b-glycosides using its transglycosylation activity pptx

... in this work (A) Consecutive additions of GlcNAc and Gal to Galb1-4GlcNAcb-pNP by b3GnT and b4GalT (B) Consecutive additions of GlcNAc and Gal to Galb1-4Glcb-pNP by b3GnT and b-D-galactosidase ... of that of The same tendency was seen in a comparison of and This was also the case for B fragilis endo-b-galactosidase as shown in Table Transglycosylation reaction of endo-b-galactosidase from ... transglycosylation and time courses of the production of transglycosylation products and 10 from and degradation of (A) HPLC analysis was performed as described in Materials and methods (B) A reaction mixture...

facile synthesis of zno micro-nanostructures with controllable morphology and

... growth of ZnO, and results in the morphology of ZnO changing from “wire” to “flower”, “urchin” and “wire” with the addition of different amounts of ammonia Due to the different surface areas of the ... urchin-like ZnO; (b) sparse urchin-like ZnO; (c) orderly ZnO nanowire; (d) flower-like ZnO; and (e) disorderly ZnO nanowire Table Photovoltaic parameters of micro-nanostructured ZnO with different ... pressure of the Teflon-sealed autoclave This will influence the growth of ZnO micro-nanostructures, leading to change in the morphology of ZnO The pH of the reaction solution increases with the...

Báo cáo hóa học: " Facile preparation of highly-dispersed cobaltsilicon mixed oxide nanosphere and its catalytic application in cyclohexane selective oxidation" ppt

... Cite this article as: Zhang et al.: Facile preparation of highly-dispersed cobalt-silicon mixed oxide nanosphere and its catalytic application in cyclohexane selective oxidation Nanoscale Research ... two kinds of solution (solutions A and B) were obtained, respectively Solution A was composed of 15.05 g of NP-7, 35.05 g of cyclohexane, and 8.05 g of n-butyl alcohol Solution B was obtained ... prepare cobalt-silicon mixed oxide materials, and the obtained material presents as a kind of highly dispersed, uniform-sized nanosphere In the catalytic application, this novel nanosphere showed...

Báo cáo hóa học: " Atomic Layer Deposition of ZnO on Multi-walled Carbon Nanotubes and Its Use for Synthesis of CNT–ZnO " doc

... morphology of the ALD ZnO shell on CNTs The ﬁrst one is the surface conﬁguration of the CNTs As a micromolecular form of carbon, CNT can be regarded as graphitic layers (sp2hybridized carbon atoms) ... that the deposited ZnO layer can be used as a seed layer for the hydrothermal growth of ZnO nanorods This provides a new method for the fabrication of CNT ZnO threedimensional (3-D) hybrid nanostructures, ... spectrum of CNTs before (a) and after (b) ALD of ZnO Inset: Raman spectrum in the range of 150–650 cm-1 of ZnOcoated CNTs a chemical vapor deposition (CVD) reaction With the occurrence of CVD reactions,...

Báo cáo lâm nghiệp: "Growth, allocation and leaf gas exchanges of hybrid poplar plants in their establishment phase on previously forested sites: eﬀect of diﬀerent vegetation" docx

... 3.4 Hybrid poplar biomass partitioning Variations in biomass partitioning were mainly associated to tree height (Tab II) In the 2YS, plants decreased their allocation to roots and rapidly increase ... testing such a set of treatments in natural conditions in regions not limited by water shortage are not common In addition, in Canada there have been few studies focusing on weed management in hybrid ... SWC monitoring was reduced to one date (in the middle of the growing season) that we consider as representative of the mean soil water conditions of the site during the measurement period On August...

Xem thêm