Acceptability, safety and contraceptive efficacy of a new single rod subdermal 3 ketodesogestrel implant in singaporean women acceptors
Acceptability, safety and contraceptive efficacy of a new single rod subdermal 3 ketodesogestrel implant in singaporean women acceptors
... Biotransformation and pharmacokinetics of desogestrel / 3- ketodesogestrel (d) Drug safety (e) Clinical data Synopsis IMPLANON™ is a new single- rod subdermal contraceptive implant containing a relatively ... fetal development, labour and delivery, lactation, neonatal viability and growth of the newborn (perinatal and postnatal studies) In the teratologic, perinatal and postnatal studies, at least ... one of the newest of the contraceptive implants, which is undergoing pre-introductory clinical trials in many parts of the world This thesis is an evaluation of safety, contraceptive efficacy and...
- 265
- 291
- 0
Báo cáo y học: " G-CSF and IL-8 for early diagnosis of sepsis in neonates and critically ill children – safety and cost effectiveness of a new laboratory prediction model: study protocol of a randomized controlled trial [ISRCTN91123847]" pps
... hospital's database This database contains all physician's reports, patient baseline data, routine laboratory results, pharmacology data, costs per R446 patient and day of specific medications ... plasma measurements of IL-8 and G-CSF and tracheal aspirate levels of G-CSF, employing a new laboratory method that allows simultaneous determination of parameters from 50 µl blood or tracheal ... that routine surveillance by determination of cytokine levels in plasma and tracheal aspirates will allow safe discontinuation of antibiotic therapy within 24 hours if the proposed laboratory prediction...
- 8
- 407
- 0
Báo cáo khoa học: "The Safety and efficacy of a new self-expandable intratracheal nitinol stent for the tracheal collapse in dogs" ppt
... (b) intratracheal placement of self expandable nitinol stent with flare ends in a dog with tracheal collapse Collapsed trachea is extended and sustained (white arrow) Intratracheal nitinol stent ... treatment of tracheal collapse in a dog J Am Vet Med Assoc 2004, 225, 1217-1221 10 Moritz A, Schneider M, Bauer N Management of advanced tracheal collapse in dogs using intraluminal self-expanding ... JA Intraluminal tracheal stenting for treatment of tracheal narrowing in three cats Vet Surg 2007, 36, 107-113 Gellasch KL, Dá Costa Gómez T, McAnulty JF, Bjorling DE Use of intraluminal nitinol...
- 3
- 576
- 0
Báo cáo khoa học: Characterization and structural modeling of a new type of thermostable esterase from Thermotoga maritima ppt
... between archaea and bacteria from genome sequence of Thermotoga maritima Nature 399, 323–329 Lim D & Strynadka A (2002) Structural basis for the b-lactam resistance of PBP 2a from methicillin-resistant ... triad, consisting of a serine in a New thermostable esterase from Thermotoga maritima GXSXG pentapeptide, an acidic aspartate, and a histidine residue The structural modeling was expected to be ... typical structural features of this type of enzyme Bacterial esterases and lipases have been classified into eight families based on a comparison of their amino acid sequences and some fundamental...
- 11
- 460
- 0
Báo cáo y học: "Childhood adversity, mental ill-health and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional system" ppt
... article as: Hermenau et al.: Childhood adversity, mental illhealth and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional ... (range - 16) at t1 and M = 9.16 years (range - 16) at t2 The Tanzanian and German board of the organization managing the orphanage gave their consent and ethical approval Materials The interview ... instructional system and the individual trauma treatment indicates a successful change in caretaking strategies The influence of the new instructional system and the psychotherapeutic treatment of PTSD...
- 9
- 405
- 0
Feasibility investigation and combustion enhancement of a new burner functioning with pulverized solid olive waste
... cake and 75 wt% coal mixture is combusted with a primary excess air of 70% and a secondary air mass flow of 40L/min Abu-Qudais and Okasha [5] have realized an important experimental study of the ... thermal systems, heat and mass transfer in porous media and combustion Prof Abdallah has published a number of papers in internationalJournals and conference proceedings E-mail address: abdmhimid@yahoo.fr ... combustion and ensure the persistence of the main flame in ambient air, two types of pilot flame are used: a central premixed flame of methane/oxygen and an annular diffusion flame of methane A preheater...
- 10
- 245
- 0
Báo cáo Y học: Molecular and biochemical characteristics of a gene encoding an alcohol acyl-transferase involved in the generation of aroma volatile esters during melon ripening pptx
... hypersensitivity-related proteins of Arabidopsis and tobacco; and (b) acyl transferases such as anthranilate N-hydroxy-cinnamoyl/benzoyl-transferase (NHCBT)-like protein of Arabidopsis and Dianthus caryophyllus, ... strawberry [9] and yeast AATs [33] CMAAT1 was capable of accepting branched alcohols such as 2- and 3-methylbutyl alcohol (also named amyl and isoamyl alcohols) The position effect of the methyl group ... CM-AAT2 and homologues, including: Arabidopsis anthranilate NHCBT, Nicotiana tabacum hsr201, Saccharomyces alcohol acetyl-transferases (ATF1 and ATF2), Catharanthus roseus Cr-DAT, Clarkia BEAT,...
- 8
- 509
- 0
Identification of a new tumor suppressor pathway modulating rapamycin sensitivity in colorectal cancer
... 3' ATGGAGGAGGACATTGATACC 3' ACATTGTATTCACCCCTACG 3' ATACGCCAGTGACGACCAGAGC 3' TAGCCCACACCATGAAAGCG 3' ATGGGAAGGTGAAGGTCGG 3' AAGACGCCAGTGGACTCCACGA 3' GTGGGGCGCCCCAGGCACCA 3' CTCCTTAATGTCACGCACGATTTC ... 3' AGTGGGCTGCGCGTCTCATTTTC 3' AAGGGTTCGTGGAGCATGGG 3' ATGGTTGCAACTGGCAGTTTG 3' AGGACCTTTGAGCAACCAAG 3' AACGGCAGCGCCTTCTTGCT 3' GGCCCATGACCAGATCAGCA 3' ATGAGCTGCACCAGAATGATCC 3' TTGGTTGTGTGAGCACTTCC ... GAPDH ACTIN TCGGCCGCGAGTACGACTA 3' TCTTGTAGCCCACGTTGTGG 3' CCCTGCTTCAGGCGTCTGTA 3' CATGCCATCTTCATCCACCT 3' GACCCGTGAGACAAAGAAGC 3' GCCCTCACACTTGACCAGTT 3' GAACTGCTATCGCATGGTCA 3' AACGTCTCCTGTGAGGATGG...
- 200
- 331
- 0
Báo cáo y học: " Safety and efficacy of a generic fixed-dose combination of stavudine, lamivudine and nevirapine antiretroviral therapy between HIV-infected patients with baseline CD4 " pot
... Anekthananon T, Ratanasuwan W, Techasathit W, Sonjai A, Suwanagool S: Safety and efficacy of a simplified fixed-dose combination of stavudine, lamivudine and nevirapine (GPO-VIR) for the treatment ... W, Kiatatchasai W, Vibhagool A: Initiation of highly active antiretroviral therapy in advanced AIDS with CD4 < 50 cells/mm3 in a resourcelimited setting: efficacy and tolerability Int J STD AIDS ... proportion of patients with plasma HIV RNA ...
- 8
- 371
- 0
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx
... 757–778 AAG AGC GCA ACT GAT AGT GCA TCC GCC ATC GAC GCA ATT AGC CTT GCT AGC AGT ACG AGG 613–630 822–839 706–723 466–483 AAG AGC AAA GAT GAT AGT GAT TAC GCC ATC CCA CAG ATT AGC ATC AAT AGC AGT CAG ... The fact that several genes can be the source of several isoforms in the branchial plume could increase global carbonic anhydrase activity Carbonic anhydrase transcripts in Riftia The two isoforms ... pseudoobscura, the mosquitoes A aegypti and A gambiae, the clam T gigas and larval sequences from the cnidarian F scutaria Finally, we chose an outgroup comprising a- CAs from a cyanobacteria (Nostoc...
- 14
- 591
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... functions and intracellular signaling Thus, our system provides an accessible method to examine the endothelial cell biology of the mouse, and will accelerate the molecular and cellular analysis of ... Heart Yolk sac Brain Embryo A chemistry using antibodies against the pan-EC marker, CD31, the lymphatic endothelial and liver sinusoidal endothelial marker Lyve-1 (lymphatic vessel endothelial...
- 11
- 873
- 0
Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf
... sub5910 strates of H+ ⁄ peptide cotransporters, such as Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala, d-aminolevulinic acid, cefadroxil and Ala-4-nitroanilide (all 100 lm, Table 1) ... UK) Dexamethasone, apotransferrin, Gly-Gln, AlaAla, Ala-Ala-Ala, Lys-Lys, d-aminolevulinic acid, cefadroxil, Gly, Pro-Ala, 8-aminooctanoic acid and Gly-Sar were from Sigma-Aldrich (Deisenhofen, ... reversible, suggesting a competitive mode of action Uptake of Bip-[3H]Pro by SKPT cells After characterization of Bip-Pro as a very high-affinity and enzymatically stable substrate of PEPT1 and PEPT2, the...
- 10
- 490
- 0
Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot
... was a mixture of 0.05 M NaPi buffer, pH 3, and acetonitrile (6 : 1, v/v); separation was performed isocratically, at a flow rate of mLÆmin)1, and the volume of injected samples was 10 lL The amounts ... concentration of both the assayed compound and its respective transformation product was determined by comparison of peak data with those obtained from authentic standards chromatographed at different ... Extraction and purification of F 4¢-OMT All the purification steps were carried out at °C temperature The enzyme was concentrated at various steps of purification using collodion bags with kDa cut-off...
- 10
- 624
- 0
Từ khóa: safety and efficacy of a unique undenatured type ii collagen in the treatment of arthritis1991 accounting and organizational cultures a eld study of the emergence of a new organizational realitysymbiosis of immunohistochemistry and proteomics marching to a new eravisions of a new elysium symbolism and allegory in gardens of the eighteenth centurythe knight of a new crusadeintroduction of a new paraphrase generation tooltemporal information processing of a new languagerocky and the eye of a tigermolar mass and chemical formula of a volatile liquidlist of input output and storage devices of a computerwork on your own initiative and as part of a teamthe subject and the object of a sentencedefine vapor pressure and boiling point of a liquidhow to write a materials and methods section of a research paperdesign and development stages of a productNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíBT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP