symbiosis of immunohistochemistry and proteomics marching to a new era
comparative phototoxicity of nanoparticulate and bulk zno to a free-living
Ngày tải lên :
06/05/2014, 13:22
... Kuykindall, T., Minella, L., 2009 Acute and chronic toxicity of nano-scale TiO2 particles to freshwater fish, cladocerans, and green algae, and effects of organic and inorganic substrate on TiO2 toxicity ... response of immortalized brain microglia to nano-TiO2 (Long et al., 2006) and in the bioavailability of nanoparticles to plant roots, algae, and fungi (Navarro et al., 2008) Nano-ZnO and bulk-ZnO ... was dramatically enhanced under natural sunlight illumination as compared to artificial laboratory light illumination This phototoxicity was well-correlated with photocatalytic ROS generation of...
- 8
- 342
- 0
managing suppliers beyond tier 1- an exploration of motivations and strategies leading to a normative model
Ngày tải lên :
02/11/2014, 00:44
... investigated to develop an understanding of why, when, and how an item from Tier and beyond was managed directly by the management of participating companies The analysis of the motivations and strategies, ... economics, and strategic management Generally speaking, managing suppliers beyond Tier falls into the area of interorganizational relationship management, and the generic interorganizational relationship ... none of them offered a complete picture of why, when, and how to manage such a trilateral business relationship [20] From the area of supply chain management, Lambert and Cooper (2000) and Lambert,...
- 292
- 220
- 0
Báo cáo khoa học: Inhibition kinetics of catabolic dehydrogenases by elevated moieties of ATP and ADP – implication for a new regulation mechanism in Lactococcus lactis potx
Ngày tải lên :
29/03/2014, 08:20
... LDH and ADH and the mixed inhibition kinetics (Eqn 3) of GAPDH with ATP, ADP, AMP and cofactor product (NAD for LDH and ADH, and NADH for GAPDH) rmse, root-meansquare error Parameter values condence ... regulator In general, intracellular concentrations of ATP and ADP in proliferating prokaryotes and yeast are in the order of 25 and 12 mm, respectively [29,30] Most studies with respect to ATP and ... dehydrogenases Table Estimated parameter values with 95% condence intervals for the multiple inhibition kinetics of LDH, ADH and GAPDH with ATP, ADP and the cofactor product (NAD for ADH and LDH, and...
- 10
- 503
- 0
A contrastive analysis of grammatical and semantic features of words and idioms related to hearing in english and vietnamese
Ngày tải lên :
26/11/2013, 13:31
... dictionaries but also relate to attitudes and feelings that are not easy for us to understand Furthermore, hearing This study aims at: - raising learners’ and users’ awareness of grammatical and may ... this reason, a contrastive analysis of English and Vietnamese in terms of semantic features? grammatical and semantic features words and idioms related to 1.5 ORGANIZATION OF THE STUDY hearing ... English and Vietnamese in terms of grammatical features? and semantic features of words and idioms related to hearing in What are the similarities and differences between WIRHs in English and Vietnamese...
- 13
- 1.3K
- 3
Tài liệu LoopStar® 711 Leveraging a Full Suite of Ethernet and TDM Services to Cost-Effectively Utilize Fiber Networks doc
Ngày tải lên :
10/12/2013, 19:15
... LPS-711 AC Package (2T1/E1, 10/100BT, 2FX, no optics) *Includes: AC power supply and AC power cord, blanking plate, 19” and 23” rack mount brackets, console cable, license for basic software and ... Round-trip and one-way delay measurements Local and remote loopbacks ANSI t1.231 reports • • • • • • • • • 102160AE LoopStar® 711 Management 2.2” high x 17” wide x 9” deep 0° to 50° C (operating) ... voice transport and now carry these TDM services along with new services such as Ethernet or Virtual Private LAN Service (VPLS) over a packet-based infrastructure to begin the migration of their...
- 4
- 405
- 0
Báo cáo khoa học: Binding of the volatile general anesthetics halothane and isoflurane to a mammalian b-barrel protein doc
Ngày tải lên :
07/03/2014, 16:20
... least-squares fit of the data to a single-site binding model 575 General anesthetic binding to a b-barrel protein J S Johansson et al Fig Competition between halothane and 1-aminoanthracene (AMA) ... binding and effects on serum albumin and myoglobin Biophys J 75, 477–483 38 Bhattacharya AA, Curry S & Franks NP (2000) Binding of the general anesthetics propofol and halothane to human serum albumin ... From mass law considerations, it then follows that Q¼ ðQmax [Halothane]Þ ðKd þ [Halothane]Þ ð1Þ Halothane displacement of bound AMA The dissociation constant of the complex between halothane and...
- 9
- 421
- 0
Báo cáo khoa học: Cytochrome P460 of Nitrosomonas europaea Formation of the heme-lysine cross-link in a heterologous host and mutagenic conversion to a non-cross-linked cytochrome c ¢ pot
Ngày tải lên :
23/03/2014, 17:21
... 5¢-AAATGCTTCAATGATAT CGAAAAAGGAAG-3¢, converted a unique SspI site on the vector to an EcoRV site The mutagenesis oligonucleotides were 5¢-GTAACTGTAAGAGAACTGGTCAC-3¢ (Lys70 to Arg), 5¢-GTAACTGTAGCAGAACTGGTCA ... D, C and B, respectively Tryptic fragments of cytochromes P460 were prepared and analyzed by MALDI-TOF mass spectrometry (Table 2) MALDI-TOF spectra of tryptic fragments of wild-type cytochrome ... maximum at 688 nm On reduction, the Soret shifts to 460 nm and the 500 and 688 nm peaks disappear but a and b maxima typical of c-type cytochromes not appear The addition of CO causes the Soret maximum...
- 7
- 384
- 1
Báo cáo toán học: "A density result for random sparse oriented graphs and its relation to a conjecture of Woodall" pptx
Ngày tải lên :
07/08/2014, 07:21
... girth of T is larger than the maximum cardinality of a family of pairwise disjoint transversals and, therefore, T is a counterexample to this generalized dual statement Thomassen’s tournament is as ... version of Woodall’s conjecture may be stated as follows: for any planar oriented graph G, the oriented girth of G is equal to the maximum cardinality of a family of pairwise disjoint transversals ... conjectured that, for any oriented graph G, a minimum oriented cut in G has cardinality equal to the maximum cardinality of a family of pairwise disjoint transversals of oriented cuts Woodall’s conjecture...
- 10
- 278
- 0
Báo cáo y học: "Vitamin supplementation for prevention of mother-to-child transmission of HIV and pre-term delivery: a systematic review of randomized trial including more than 2800 women" potx
Ngày tải lên :
10/08/2014, 05:20
... factorial trial assessing the impact of vitamin A, and of multivitamins excluding Vitamin A, on vertical transmission of HIV-1 and child mortality on pregnant women in Dar es Salaam, Tanzania ... weeks of age, making HIV status undeterminable Multivitamins As described above, the factorial trial of Fawzi et al (2002) [19] performed examined the impact of both vitamin A and multivitamins of ... a different underlying effect for each study and takes between-study variability into consideration as an additional source of variation These effects are assumed to be randomly distributed and...
- 7
- 392
- 0
Báo cáo y học: "Global transcriptional responses of fission and budding yeast to changes in copper and iron levels: a comparative study" ppt
Ngày tải lên :
14/08/2014, 07:21
... Fep1p regulation in S pombe, including novel regulatory targets Details are given in the text Fep1p Fep1p * attacaTCTGATAActTTTGTCcagattgGTAGA TAAgcaa taatgtagactattgaaaacaggtctaaccatct attcgtt ... Metallothioneins Catalase A, peroxisomal and mitochondrial Catalase T, important for free radical detoxification Cu/Zn superoxide dismutase Cell wall mannoprotein 3-ketoacyl-CoA; beta-oxidation of fatty acids ... nitrogen cDNA labeling, microarray hybridization, and data acquisition For S cerevisiae, total RNA isolation, cDNA synthesis and labeling, microarray production, and hybridization was done as described...
- 16
- 839
- 0
grid computing esis analysis of its impact on business and the shift to a services infrastructure
Ngày tải lên :
30/09/2014, 22:23
... WHAT IS DRAMATICALLY NEW ABOUT ABOUT GRIDS? a a a a GRIDS BEGIN AS A WAY TO ACCELERATE COMPUTING THEY EVOLVE TO A TECHNOLOGY THAT MAKES APPLICATIONS INFRASTRUCTURE AWARE THIS IMBEDS ... multi-purpose protocols and interfaces that address such fundamental issues as authentication, authorization, resource discovery, and resource access – these protocols and interfaces must be standard and ... CONCLUSIONS a a a a COLLABORATION USING GRIDS CAN LEVERAGE THE BENEFITS OF COMPUTE POWER AND USE EXCESS COMPUTE CAPACITY THAT IS AVAILABLE NOW MOST CXOs ARE NOT AWARE OF THIS CHANGE RFID HAS GOTTEN...
- 41
- 212
- 0
Báo cáo y học: "Management of chest pain: exploring the views and experiences of chiropractors and medical practitioners in a focus group interview"
Ngày tải lên :
25/10/2012, 10:06
... musculoskeletal origin Chiropractic and medical participants both noted lack of formal clinical studies examining effectiveness of manual/manipulative approaches to manage (diagnose and treat) musculoskeletal ... preclinical and clinical trial work along this line of inquiry Education and educational research What becomes obvious is that a lack of research has impact and implications for the education of both ... 'diagnosis' and 'treatment' whether in managing a given patient in actual practice or in attempting to define an appropriate evidence-based professional 'standard of care' This is perhaps particularly...
- 10
- 788
- 0
Application of Hydrothermal Reaction to Biodegradability Improvement of Refractory Pollutants: Structural Conversion of Di- and Trichloroacetic Acid to Biodegradable Products
Ngày tải lên :
05/09/2013, 08:40
... of CAAs in the field and laboratory study Initial water quality indexes of DCAA and TCAA did not change in ambient water Since the deviation of water quality indexes was less than % of each average ... initial biodegradability of DCAA and TCAA was almost zero Under the reaction conditions of 250 oC and MPa, biodegradability of DCAA increased to 0.54 within min, and did not vary much up to reaction ... reaction time of 57 In case of TCAA, the biodegradability change was similar to that of DCAA It can be explained by the fact that the structural conversion from DCAA and TCAA to biodegradable products...
- 8
- 643
- 0
Sensibility study of flooding and drying issues to the operating conditions in PEM fuel cells
Ngày tải lên :
05/09/2013, 14:58
... storage and electrical energy generation system, control and measurements He is the author of more than 70 publications and has patents Pr Agbossou is also a PES-IEEE member and former Chair of ... multi-component gas transport in the gas diffusion layers and in the bipolar plate channels It also describes water transport in the membrane This model is used to analyze the role that each operating parameters ... analyzed In the analysis, dead-end and flow-through modes of hydrogen supply are also compared Operating cell temperature has a strong influence on the critical current and can dramatically influence...
- 20
- 571
- 0
Tài liệu Applications of Robotics and Artificial Intelligence to Reduce Risk and Improve Effectiveness pdf
Ngày tải lên :
13/12/2013, 01:15
... quick-change mechanisms and a family of hand grippers and robot tools would rapidly become available The development of a dexterous hand is still a research issue Many laboratories in this country and ... solution AUTOMATIC LOADER OF AMMUNITION IN TANKS At present the four-man crew of a U.S tank consists of a commander, a gunner, a driver, and a loader The loader receives verbal instructions to load a ... such as night attack and air assault can be used to adapt the general battalion expert system to the particular battle situation 27 IMPLEMENTATION OF RECOMMENDED APPLICATIONS For the applications...
- 276
- 593
- 0
Tài liệu Create a Dialog Box to Connect to a New Database, Including Listing Available SQL Servers and Databases pdf
Ngày tải lên :
21/01/2014, 12:20
... string Called BuildCnnStr, the function can be seen in Listing 7.1 This function takes a server and database names passed to it and returns a connection string You will want to create a basic module ... establishing an instance of the SQL-DMO application, the code calls the ListAvailableSQLServer method If no names are loaded into the oNames namelist object (meaning that they were not available or you ... TextBox Command Button As with some of the other chapters' projects, before creating the code that will be attached to the Load event of the form, you need to create a support routine to create the...
- 10
- 477
- 0
Tài liệu Báo cáo khoa học: Lipopolysaccharide-evoked activation of p38 and JNK leads to an increase in ICAM-1 expression in Schwann cells of sciatic nerves ppt
Ngày tải lên :
18/02/2014, 18:20
... Statistical analysis All data were analyzed using stata 7.0 statistical software (Systat Software Inc., San Jose, CA, USA) The OD of the immunoreactivity is represented as means ± SEM Oneway ANOVA ... Gram-negative bacteria, and its recognition and signal transmission are key events in the host defense reaction towards Gram-negative bacteria Generally, LPS activates monocytes and macrophages to ... 11641–11645 Roebuck KA, Rahman A, Lakshminarayanan V, Janakidevi K & Malik AB (1995) H2O2 and tumor necrosis factor-alpha activate intercellular adhesion molecule (ICAM-1) gene transcription through...
- 11
- 519
- 0
Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx
Ngày tải lên :
19/02/2014, 05:20
... dried and autoradiographed using Phosphorimager Storm Band intensities on the gels were quantified with image-quant software Average values and standard errors shown in the graphs were calculated ... repair processes that, in general, confer chemoresistance to cancer cells The other pathway leads to programmed cell death through activation of proapoptotic genes such as Bax, PUMA and Noxa [1–3] ... Nakagawara A, Sakuma Y, Kimura S, Ikeda T, Satoh M, Takahashi N, Sato N & Mori M (2000) p73: structure and function Pathol Int 50, 589–593 23 Levrero M, De Laurenzi V, Costanzo A, Gong J, Wang...
- 14
- 597
- 0
Life and Physical Sciences Research for a New Era of Space Exploration docx
Ngày tải lên :
05/03/2014, 11:21
... Administrative Coordinator TANJA PILZAK, Manager, Program Operations CELESTE A NAYLOR, Information Management Associate CHRISTINA O SHIPMAN, Financial Officer SANDRA WILSON, Financial Assistant ... extension of the availability of the ISS to 2020 and beyond provides a platform to fulfill two major goals: (1) to increase both basic and translational knowledge of animals and humans on a variety of ... database) Coupling the database with a genetic bank and repository of astronaut samples would ensure the availability of the maximal amount of data to address future investigations Because of...
- 47
- 606
- 0