0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Synthesis and characterization of group 11, 12 and 13 metal selenocarboxylates potential single molecular precursors for metal selenide nanocrystals 1

Synthesis and characterization of group 11, 12 and 13 metal selenocarboxylates potential single molecular precursors for metal selenide nanocrystals 3

Synthesis and characterization of group 11, 12 and 13 metal selenocarboxylates potential single molecular precursors for metal selenide nanocrystals 3

... 7.45 (4H, t, J = Hz, meta-proton) 13 C NMR δc (d6-DMSO): For 134 Chapter ZnSe & CdSe NPs selenobenzoate ligand: 127 .12 (C2/6 or C3/5), 128 .61 (C2/6 or C3/5), 131 .05 (C4), 142.94 (C1), 201.50 (COSe) ... Experimental d-spacing d-spacinga 3. 659 3. 665 0 3. 611 3. 611 0 3. 460 3. 460 3. 235 3. 239 2 .122 2 .122 2.094 2.086 1.951 1.942 1.809 1.802 2 1.792 1.781 a d-spacing of the distinct visible peaks from ... TolC{O}Se-, - 100%), 199 .3 (TolC{O}Se-, 30 %) TGA for one H2O: 3. 75 % (Calc.); 3. 56 % (Obs.) [Cd(SeC{O}Ph)2], 13 The synthesis of 13 is similar to 12 except CdCl2 and [Na+PhC{O}Se–] were used in the...
  • 69
  • 307
  • 0
Synthesis and characterization of group 11, 12 and 13 metal selenocarboxylates potential single molecular precursors for metal selenide nanocrystals 1

Synthesis and characterization of group 11, 12 and 13 metal selenocarboxylates potential single molecular precursors for metal selenide nanocrystals 1

... NPs··················································· IR spectra of TOPO, ZnSe and CdSe NPs··································· 12 4 12 5 12 5 12 6 12 7 12 7 12 7 12 8 12 9 13 0 13 0 13 1 13 2 13 2 13 3 Chapter Figure 9 .1 Figure 9.2 Figure 9.3 Figure ... Powder Diffraction 18 0 12 . 10 Single Crystal X-ray Diffraction 18 0 12 . 11 Scanning Electron Microscope 18 0 12 . 12 TEM 18 0 12 . 13 EDX 18 1 12 . 14 NLO Measurement 18 1 References 18 1 Appendix 18 2 VII Abbreviations ... Group 12 Metal Thio- and Selenocarboxylates 1. 3 .1 Neutral Group 12 Metal Thio- and Selenocarboxylates Containing N-donor Ligands 1. 4 11 Other Metal Thiocarboxylates 1. 4 .1 12 Group 13 Metalloligands...
  • 109
  • 312
  • 0
Synthesis and characterization of group 11, 12 and 13 metal selenocarboxylates potential single molecular precursors for metal selenide nanocrystals 2

Synthesis and characterization of group 11, 12 and 13 metal selenocarboxylates potential single molecular precursors for metal selenide nanocrystals 2

... Copper Selenide NPs Synthesis of Cu2-xSe NPs and Microflakes from [(Ph3P)3Cu2(SeC{O}Ph )2] 7.1 Introduction Cu2-xSe is an extrinsic p-type semiconductor with a direct band gap of 2. 2 eV and an ... of solvent on the formation of Cu2-xSe NPs 7 .2 Formation and Characterization of Cu2-xSe NPs and Microflakes 7 .2. 1 HDA and TOP as Surfactants The TEM images of Cu2-xSe NCs obtained from HDA solution ... of Ag2Se nanocubes and examine the roles of parameters critical to the formation of Ag2Se NCs 6 .2 Results and Discussion 6 .2. 1 Formation of Ag2Se NCs from [(Ph3P)3Ag2(SeC{O}Ph )2] Previously, our...
  • 45
  • 393
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Design and Characterization of a 5.2 GHz/2.4 GHz ΣΔ Fractional-N Frequency Synthesizer for Low-Phase Noise Performance" potx

... simulations on the divider can be performed The crystal oscillator is normally a commercially available part and data on its phase noise performance is often available from the manufacturer The ΣΔ ... measured and simulated phase noise for the 3.2-3.3 GHz band The square dots are the simulated data synthesizer phase noise performance The model can serve as a design guide for synthesizer designers ... University of Central Florida under a Motorola Research Grant on SAW device package electrical characterization and oscillator design From 1991 to 1995, he was a Staff and Lead Oscillator Design Engineer...
  • 11
  • 416
  • 0
Báo cáo khoa học: Characterization of SCP-2 from Euphorbia lagascae reveals that a single Leu/Met exchange enhances sterol transfer activity pdf

Báo cáo khoa học: Characterization of SCP-2 from Euphorbia lagascae reveals that a single Leu/Met exchange enhances sterol transfer activity pdf

... mutagenesis: ELM13M14 (5¢-AAGTCCCAAAATATTATGGA TATGATGGCTCGATTTCTCGAG-3¢); ELE28 (5¢-ATG AAAGTTCAAGAGAAGATCAATCTC-3¢); ELM99 (5¢ATGAGGGGTGCTATGAAGATCAAGG-3¢); ATL100 (5¢-ATTAGGGGTGCGCTGAAGATCAAGG-3¢); ... for E lagascae SCP-2 (SCPElNE, 5¢-ACTGGAA TTCAACTCAAGTCCCAAAATATTTTGGAT-3¢; SCPElCN, 5¢-TCATGGCGGCCGCTCACAGCTTCGACGGCTTGG GGAA-3¢) and E lagascae EF1 -a (ELEFF, 5¢-TATGGT GGTTGAGACTTTTGCAG-3¢; ... 5647 SCP-2 from Euphorbia lagascae L Viitanen et al Table Lipid -transfer activity of E lagascae and A thaliana SCP-2 mutants Normalized decrease in BODIPY-PC transfer rate mediated by different A...
  • 15
  • 391
  • 0
Báo cáo y học:

Báo cáo y học: " Kennedy Institute of Rheumatology Division, Imperial College London, 12–13 November 2003: Towards a molecular toolkit for studying lymphocyte function in inflammatory arthritis" ppt

... (University of Cambridge School of Clinical Medicine, UK) presented data from a murine model of inflammatory arthritis that suggested a role for regulatory T cells in the repression of arthritis and ... tolerated for decades, without global immunosuppression, they seem a promising therapeutic strategy for Th1-dominant inflammatory diseases, such as RA Homing and effector function Frances Hall ... stimulated in vitro upregulated telomerase This was inhibited by fluid obtained from inflammatory blisters and might explain the limitation of expansion of specific T cells at sites of inflammation...
  • 5
  • 256
  • 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢ For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the ... chain and hides a large amount of the hydrophobic surface area Surface area calculations for the pentamer give a total surface ˚ ˚ area of $ 81 000 A2 with 30% ($ 24 000 A2 ) as contact area Thus, ... Human adenovirus ⁄ 12 penton base chimera C Zubieta et al Fig The hAd2 ⁄ 12 and wild-type hAd2 penton base monomers (A) Ribbon diagram of the hAd2 ⁄ 12 penton base monomer is in blue (left) and...
  • 10
  • 647
  • 0
Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx

Tài liệu Báo cáo khóa học: Characterization of the products of the genes SNO1 and SNZ1 involved in pyridoxine synthesis in Saccharomyces cerevisiae pptx

... to the 9th cycle from the N-terminus including the initiating Met: MHKTHSTMS for Sno1p and MTGEDFKIKS for Snz1p Properties of the complex of Sno1p and Snz1p When Sno1p with a His-tag and Snz1p ... SNO3, SNZ2 and SNZ3 complement the defect The relationship of all of these genes remains to be clarified Expression and purification of Sno1p and Snz1p In light of the similarity in the amino acid ... Sequencing of the mutated genes revealed that there was indeed a mutation on both of the genes In SNO1, the 199th G from the 5¢ terminus of the open reading frame was deleted to result in a frame-shift...
  • 8
  • 649
  • 0
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

... alkylation leading to a depletion of mtDNA in intact cells (Fig 1) Here we report the synthesis and characterization of a novel mitochondria- targeted alkylating reagent and show that it alkylates ... One approach to increase the duration of PNA binding to DNA is to conjugate it to a DNAalkylating reagent so that the PNA becomes covalently bound to its target sequence To this a DNA alkylating ... molecular mass markers be further accumulated within the mitochondria due to the mitochondrial membrane potential [11] From the known plasma and mitochondrial membrane potentials and the cell and mitochondrial...
  • 10
  • 638
  • 0
Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf

Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf

... sub5910 strates of H+ ⁄ peptide cotransporters, such as Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala, d-aminolevulinic acid, cefadroxil and Ala-4-nitroanilide (all 100 lm, Table 1) ... UK) Dexamethasone, apotransferrin, Gly-Gln, AlaAla, Ala-Ala-Ala, Lys-Lys, d-aminolevulinic acid, cefadroxil, Gly, Pro-Ala, 8-aminooctanoic acid and Gly-Sar were from Sigma-Aldrich (Deisenhofen, ... reversible, suggesting a competitive mode of action Uptake of Bip-[3H]Pro by SKPT cells After characterization of Bip-Pro as a very high-affinity and enzymatically stable substrate of PEPT1 and PEPT2, the...
  • 10
  • 490
  • 0
Báo cáo khoa học: Characterization of the tRNA and ribosome-dependent pppGpp-synthesis by recombinant stringent factor from Escherichia coli pot

Báo cáo khoa học: Characterization of the tRNA and ribosome-dependent pppGpp-synthesis by recombinant stringent factor from Escherichia coli pot

... 6E) From these results it can be concluded that tRNAs were bound in classical states with the tRNAMet bound f in the P-sites of the 30S and 50S subunits and the tRNAPhe bound in the A-site of the ... SF and tRNA were added simultaneously to the reaction mixtures, in agreement with the results presented by Wendrich et al [7] tRNA and ribosome-dependent synthesis by stringent factor the tRNA ... and purified SF from E coli and examined the ribosome, template and tRNA- dependence of the pppGpp synthesis reaction Purification of recombinant SF We started out by purifying SF by affinity-chromatography...
  • 11
  • 446
  • 0
Báo cáo

Báo cáo " Sol-gel synthesis and particle size characterization of CdSe Quantum dots " ppt

... preparation of CdSe quantum dots (QDs) by sol-gel method and investigate their optical properties This is a new route to get CdSe QDs and also very economic We also estimate the average size of QDs ... prepared CdSe nanoparticles and the positions of the Xray peaks for CdSe FCC are shown in Fig All the diffraction peaks from the CdSe nanoparticles are consistent with the wurtzite structure of CdSe ... calculate the mean sizes of the CdSe QDs from the peak width at half-maximum Particle sizes obtained from the width of the (111) diffraction are depicted in the table Table Particle size of samples with...
  • 5
  • 469
  • 1
Synthesis and characterization of silicon nanowires using tin catalyst for solar cells application

Synthesis and characterization of silicon nanowires using tin catalyst for solar cells application

... characteristics of the fabricated SiNWs solar cell under dark and light conditions the thickness of Si base substrate more thinly For improvement of conversion efficiency of the SiNWs solar cells, the ... performance Therefore, further reduction of the reflectance will be expected from the optimization of the synthesis conditions of SiNWs For analysis of the electrical properties, the I–V curve of the fabricated ... difference of the reflectance might be the effect of synthesis conditions, such as thickness of metal film and SiH4 gas flow The reduction of reflectance is very helpful to improve the solar cell performance...
  • 3
  • 805
  • 0
Synthesis and characterization of semiconducting nanowires for gas sensing

Synthesis and characterization of semiconducting nanowires for gas sensing

... the electrical and gas sensing behavior of ZnO nanowires Fig Characteristics of In3 O2 nanowires: (a) SEM image of In3 O2 nanowires, (b) TEM image of nanowire 70 nm in width, and (c) ED pattern ... image of a nanowire, and (e) linescan of the HAADF signal (solid line) and numerical fit of the shape of the nanowire (dashed line) As both composition and phase can be considered uniform for the ... useful for investigation of the termination of the nanowire lateral sides and apex Electron diffraction (ED) and analysis of zero-order and higher-order Laue-zones allows precise determination of...
  • 6
  • 662
  • 0
Báo cáo khoa học: Synthesis and characterization of Pi4, a scorpion toxin from Pandinus imperator that acts on K+ channels doc

Báo cáo khoa học: Synthesis and characterization of Pi4, a scorpion toxin from Pandinus imperator that acts on K+ channels doc

... El Ayeb, M., Rochat, H., Allen, P.D., Pessah, I.N., De Waard, M & Sabatier, J.M (2000) Chemical synthesis and characterization of maurocalcine, a scorpion toxin that activates Ca2+ release channel/ryanodine ... synthesis and characterization of Pi1, a scorpion toxin from Pandinus imperator active on K+ channels Eur J Biochem 267, 5149–5155 Lebrun, B., Romi-Lebrun, R., Martin-Eauclaire, M.-F., Yasuda, A. , ... Functional map of Pi4 towards rat Kv1.2 channel, and comparison with that of Pi1 Functional maps of Pi4 [1] and Pi1 [5–7] (A and B, respectively) The structures of scorpion toxins are shown according...
  • 10
  • 503
  • 0

Xem thêm

Từ khóa: thermal oxide synthesis and characterization of fe3o4nanorods and fe2o3 nanowiressynthesis solubilisation and characterization of cdse zns core shell qdssynthesis and electrochemical performance of lifepo4 by solgel methodsynthesis and electrochemical performance of graphenepolyanilinesynthesis and electrochemical performance of graphenelike ws2order of group elements ab and baproperties of group iii nitridesinstitution of engineering and technology 1994ecosystems and human wellbeing health synthesis a report of the millennium ecosystem assessmenta study of group work and its effect in general english classesisolation and characterization of vascular endothelial cells from murine heart and lungisolation and characterization of embryonic and adult epicardium and epicardium derived cellsname address of registered offices and legal form of group companies specifying the following for each onegroup companies and associates current under current liabilities in the balance sheet the current portion of non current payables shall be transferred to this subgroup from the corresponding accounts in subgroup 16financial reporting of sources and applications of funds aas 122measurement synthesis and materialization of manufacturing informationBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP