0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 4

Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 4

Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 4

... to fixing in 4% formaldehyde for 1min Before the stain solution was added, the cells were again rinsed thrice with PBS to remove the fixative The samples were then incubated for 15min in the dark ... induction, the drug was removed from the cells by changing the culture medium The E14tg2a cells were fed daily with fresh medium containing no Doxycyclin 4. 14. 1.3 Treatment with Activin E 14 cells ... Activin A (R&D Systems) in chemically defined, LIF free medium for the entire duration of the experiment The E 14 cells were fed daily with medium containing fresh Activin A 4. 14. 2 Inhibition of...
  • 24
  • 298
  • 0
Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 2

Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 2

... 2. 1 ES cell secretion of LEFTY2 maintains pluripotency 2. 1.1 Introduction The molecular basis of self- renewal and the maintenance of pluripotency in ES cells have yet to be ... secreted into and deposited in the ES cell microenvironment 79 2. 1 .2. 8 LEFTY2 maintains ES cell self renewal by inhibiting Nodal signaling Next, the mechanism of LEFTY2 action was dissected The fact ... analyses against the V5 tag detected the presence of both the precursor (42kDa) and processed forms of LEFTY2 (34kDa and 62 28kDa) in the medium conditioned by the transfected E14 cells (Figure 12b)...
  • 117
  • 415
  • 0
Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 3

Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 3

... signals dictate embryonic stem cell fates is also not entirely clear Conflicting roles of Nodal signaling in both the maintenance of ES cell self renewal and induction of ES cell differentiation ... be learnt The primary aim of this project hence serves to identify and delineate the roles of additional factors and pathways that are important for the maintenance of ES cell self- renewal To ... SMAD3 Part of this thesis serves to dissect the individual contribution of SMAD2 and SMAD3 towards the various cell fate arbitrated by Nodal signaling Here, data showing that inhibition of SMAD3...
  • 4
  • 184
  • 0
Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 5

Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 5

... Bucay, N., Hinton, A., Firpo, M T., King, C C., and Hayek, A (20 05) Activin A maintains pluripotency of human embryonic stem cells in the absence of feeder layers Stem Cells 23, 489-4 95 Besser, ... H., and Miyazono, K (2007) Activin-Nodal signaling is involved in propagation of mouse embryonic stem cells J Cell Sci 120, 55 - 65 Oh, S P., and Li, E (1997) The signaling pathway mediated by the ... H D., and Andrews, P W (2004) Specific knockdown of Oct4 and beta2microglobulin expression by RNA interference in human embryonic stem cells and embryonic carcinoma cells Stem Cells 22, 659 -668...
  • 13
  • 229
  • 0
Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency

Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency

... the unleashing of the immense potential of ES cells is however the current incomplete understanding of the molecular mechanism underlying self renewal and cell fate determination of ES cells 1.2 ... pluripotent embryonic stem (ES) cell lines The derivation of pluripotent cell lines from blastocysts was first achieved in the murine system in 1981 by Martin Evans and Matthew Kaufman and independently ... underlying ES cell self renewal Despite the importance of stem cell self renewal, we are only beginning to understand how it is regulated ES cell self renewal is a complex process that involves...
  • 41
  • 312
  • 0
Appendix  identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency

Appendix identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency

... protein Member of TGFsuperfamily Involved in Nodal signaling Nodal antagonist • • • • • Rex2 • Zinc finger protein • • • Zfx • • • a-catenin • Zinc finger protein Transcription factor Link to ... -catenin (Catnb) Dot1l Lef1 Gata3 • • • • • • • • complex Involved in Wnt signaling Subunit of Cadherin protein complex Intracellular mediator of canonical Wnt signaling Non-SET domain protein Histone ... presented in this thesis, the relative transcript levels for the Ct method gene of interest between test sample and control were tabulated using the -Actin was used as the housekeeping gene for...
  • 12
  • 183
  • 0
Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot

Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot

... contains 535 amino acids with a calculated average molecular mass of 57 752 Da and the a- subunit contains 808 amino acids with a calculated average molecular mass of 87 392 Da The total calculated ... (ggcaggaattgaatgcag) or the known 3¢ end of the xdhB gene (gcccagtacctacaagattc) Localization of xdhAB genes on the C acidovorans plasmid was established using the AlkPhos Fig Location of the ... and characterization of xanthine dehydrogenase in a baculovirus-insect cell system In Flavins and Flavoproteins 1993 Proceedings of the 11th International Symposium on Flavins and Flavoproteins...
  • 11
  • 584
  • 0
Báo cáo y học:

Báo cáo y học: "A novel scheme to assess factors involved in the reproducibility of DNA-microarray data" pdf

... A novel scheme to assess factors involved in the reproducibility of DNA-microarray data Running title: a novel scheme to assess DNA-microarray data quality Sacha A.F.T van Hijum1, ... show that the latter factors are indeed important for optimizing DNA-microarray data quality In order to assess the reproducibility of- and factors involved in DNA-microarray data produced in our ... enzyme for the Cy3 label and (ii) prolonged exposure to air and light of the dyes increasing the chance of oxidation and / or bleaching The main contributing factors identified in this study are...
  • 35
  • 274
  • 0
Asymmetric cell division in the regulation of neural stem cell self renewel in drosophila melanogaster

Asymmetric cell division in the regulation of neural stem cell self renewel in drosophila melanogaster

... development of multicellular organisms, it is also a means of keeping stem cell self- renewal and differentiation in balance During asymmetric division of neural stem cells in Drosophila melanogaster; ... through asymmetric division Each stem cell generates another stem cell and a sibling daughter cell destined to differentiate B Extrinsic versus intrinsic regulation of asymmetric division Extrinsic ... determinants during neuroblast asymmetric cell division results in both the daughter cells adopting a stem cell- like identity upon division In the absence of these basal targeting adaptor proteins...
  • 150
  • 284
  • 0
Báo cáo y học:

Báo cáo y học: ":Identification of novel stem cell markers using gap analysis of gene expression data" ppsx

... ebf4 ebf1 ebf2 cyp1a1 cyp1a2 cyp1b1 ) Figure Phylogenetic distribution of stem cell markers and their close paralogs in four protein families Phylogenetic distribution of stem cell markers and their ... undergone repeated gene duplication events for a phylogenetic analysis of the evolution of proteins involved in stem cell function By sequence similarity analysis, we identify four such families ... giving rise to genes with a very high degree of sequence similarity, but very different patterns of expression in stem cells This leads to a hypothesis that many stem cell related genes expressed...
  • 19
  • 340
  • 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

... seen in the putative T-box DNA-binding domain of t-bet, the STAT protein interaction domain, STAT protein all-alpha domain, STAT protein DNA-binding domain and SH2 domain of stat6, and the zinc-finger ... implicated in other protein–protein interactions, a STAT protein DNA-binding domain and an SH2 domain, which binds phosphorylated tyrosine residues in the context of a longer peptide motif within a ... expression of these genes within humans and mice, of T-bet within Ginbuna crucian carp [27] and STAT6 in mandarin fish [28] have shown similar widespread expression In the case of STAT6, highest...
  • 20
  • 689
  • 0
Báo cáo y học:

Báo cáo y học: "Identification of new autoantibody specificities directed at proteins involved in the transforming growth factor b pathway in patients with systemic sclerosis" pot

... this article as: Bussone et al.: Identification of < /b> new < /b> autoantibody < /b> specificities < /b> directed < /b> at < /b> proteins < /b> involved < /b> in < /b> the < /b> transforming < /b> growth < /b> factor < /b> b pathway in < /b> patients with systemic sclerosis ... 4) Thus, the < /b> expression of < /b> these proteins < /b> can be either increased or decreased by TGF -b Interestingly, some of < /b> these proteins < /b> are involved < /b> in < /b> the < /b> pathophysiological process of < /b> SSc Bussone et ... (y-< /b> axis) B and D are magnifications of < /b> the < /b> delineated zones in < /b> A and C, respectively Proteins < /b> of < /b> interest are indicated by the < /b> protein ID provided by ImageMaster 2D Platinum 6.0 software or their...
  • 13
  • 297
  • 0
The symmetric dimethylation of histone h3 arginine 2  a novel histone mark involved in euchromatin maintenance

The symmetric dimethylation of histone h3 arginine 2 a novel histone mark involved in euchromatin maintenance

... Arginine Deaminase (PADI4), a nuclear member of the PADI family, promiscuously deiminates arginines on histone H3 (H3R2, H3R8, H3R17, and H3R26) and that deimination by PADI4 counteracts arginine ... ARGININE METHYLATIONS LINKED TO TRANSCRIPTIONAL ACTIVATION: H4/H2AR3me 2a, H3R17me 2a, H3R26me 2a 1.3.3.1 H4R3me 2a and H2AR3me 2a Methylation of arginine at position on the histone H4 tail was the first ... BIOCHEMISTRY OF PROTEIN ARGININE METHYLATION 13 1.3 .2 HISTONE ARGININE METHYLATION 13 1.3.3 ARGININE METHYLATIONS LINKED TO TRANSCRIPTIONAL ACTIVATION: H4/H2AR3me 2a, H3R17me 2a, H3R26me 2a 13...
  • 223
  • 703
  • 0
Risks Involved in the Use of Herbal Products

Risks Involved in the Use of Herbal Products

... discrepancy exists in the antioxidant and other bioactivities of flavonoids, which are powerful in assays conducted in vitro; the 14 Risks Involved in the Use of Herbal Products 357 measured in vivo activities ... were consistent in classifying the antioxidant capacity of the polyphenol-rich beverages in descending order: Punica granatum L (pomegranate) 14 Risks Involved in the Use of Herbal Products 355 ... aspirin or other NSAIDs may increase the risk of bleeding Ginseng may intensify the effects of these drugs, causing an excessive decrease in blood sugar levels (hypoglycemia) Ginseng may intensify...
  • 15
  • 396
  • 0
Tài liệu Báo cáo khoa học: Crystal structure of thiamindiphosphate-dependent indolepyruvate decarboxylase from Enterobacter cloacae, an enzyme involved in the biosynthesis of the plant hormone indole-3-acetic acid doc

Tài liệu Báo cáo khoa học: Crystal structure of thiamindiphosphate-dependent indolepyruvate decarboxylase from Enterobacter cloacae, an enzyme involved in the biosynthesis of the plant hormone indole-3-acetic acid doc

... Evidence for the presence of DNA-binding proteins involved in regulation of the gene expression of indole-3pyruvic acid decarboxylase, a key enzyme in indole-3-acetic acid biosynthesis in Azospirillum ... the aminopyrimidine ring, are conserved in all ThDP-dependent enzymes One of these, the hydrogen bond between the N1¢ atom of the pyrimidine ring of ThDP and the side chain of an invariant glutamate ... FEBS 2003 3D structure of indolepyruvate decarboxylase (Eur J Biochem 270) 2313 Fig The indole-3-pyruvic acid pathway for the biosynthesis of the plant hormone indole-3-acetic acid in Enterobacter...
  • 10
  • 557
  • 0

Xem thêm

Từ khóa: are epigenetic factors involved in the normal expression of neuronal phenotypes during spinal developmentfactors involved in the pro oxidant activity of carotenoidsa primary factors involved in the occurrence of disease susceptible hostsidentification of cancer stem cell related micrornas in hepatocellular carcinomafunctional identification of neural stem cell derived oligodendrocytesimaging of embryonic stem cell migration in vivo1 the future of pluripotent stem cell derivation characterization and cultureanalysis of embryonic stem cell derived osteogenic cultures pdfanalysis of arrhythmic potential of embryonic stem cell derived cardiomyocytes pdfregenerative medicine in the central nervous system stem cell based gene therapyindian tribes involved in the trail of tearsnative american tribes involved in the trail of tearswhich native american tribe was involved in the trail of tearswhat indian tribe was involved in the trail of tearswhich indian nation was involved in the trail of tearsGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM