Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase Nikolai V. Ivanov 1 , Frantisek Huba ´ lek 2 , Manuela Trani 1 and Dale E. Edmondson 1,2 Departments of 1 Chemistry and 2 Biochemistry, Emory University, Atlanta, GA, USA Previous work from this laboratory has shown that the spectral and functional properties of a prokaryotic xanthine dehydrogenase from Comamonas acidovorans show some similarities to those of the well-characterized eukaryotic enzymes isolated from bovine milk and from chicken liver [Xiang, Q. & Edmondson, D.E. (1996) Biochemistry 35, 5441–5450]. Therefore, this system was chosen to study the factors involved in the expression of functional recombinant enzyme in Escherichia coli to provide insights into the assembly of the functional Mo-pyranopterin center. Genes xdhA and xdhB (encoding the two known subunits of the native enzyme) and putative genes xprA and ssuABC were sequenced. Heterologous expression of the xdhAB genes in E. coli JM109(DE3) produced active enzyme. The Mo content was 0.11–0.16 mol per ab protomer, while the Fe and FAD levels were at stoichiometries similar to that of the native enzyme. The XDH activity increased sixfold when the culture was grown under conditions of low aeration (6 LÆmin )1 ) as compared with high aeration (12 LÆmin )1 ). Co-expression of the xdhAB genes with the Pseudo- monas aeruginosa PA1522 (xdhC) gene increased the level of Mo incorporated into the expressed enzyme to a 1 : 1 stoi- chiometry. Under these conditions, high levels of functional protein (2.284 UÆmg )1 and 8.039 mgÆL )1 of culture) were obtained independently of the level of culture aeration. Therefore, the assembly of a functional Mo-pyranopterin center in XDH requires the presence of a functional xdhC gene product. The purified, recombinant XDH shows spectral and kinetic properties identical to those of the native enzyme. Keywords: xanthine dehydrogenase; Comamonas acidovo- rans; prokaryote; molybdopyranopterin; FAD. Xanthine oxidoreductases have been extensively investi- gated because of their physiological and medical importance [1], serving as a prototype for the study of multiredox centers in an enzyme system. They belong to a group of molybdenum hydroxylases that catalyze the hydroxylation of substrates using solvent water as the oxygen source. Hydroxylation of hypoxanthine to xanthine and of xanthine to uric acid is considered to be their major biological function in purine catabolism, with either NAD + [for the xanthine dehydrogenase (XDH) form] or O 2 [for the xanthine oxidase (XO) form] acting as electron acceptors. XDHs are found in both prokaryotes and eukaryotes, with the enzymes isolated from bovine milk, chicken liver and Rhodobacter capsulatus being functionally and struc- turally the best characterized [2,3]. These enzymes contain one FAD, two [2Fe)2S] centers, and one molybdopyra- nopterin monophosphate (MPT; the site for substrate hydroxylation), per subunit. A cyanolyzable terminal sulfur ligand on the Mo center [4] is absolutely required for catalytic activity. With the recent determinations of the crystal structures of both a eukaryotic (from Bos taurus [5]) and a prokaryotic (from R. capsulatus [6]) XDH, detailed mechanistic probes of the function of the Mo center in the hydroxylation reaction would benefit from site-directed mutagenesis studies of recombinant XO/XDH. The detailed molecular mechanism of substrate hydroxylation and other questions have remained unanswered owing to a lack of progress in the expression of functional eukaryotic XDHs at high levels. Heterologous expression of recombinant Rattus norvegicus XDH in a baculovirus system [7] resulted in a predominantly Correspondence to D. E. Edmondson, Department of Biochemistry, Emory University School of Medicine, Rollins Research Center, 1510 Clifton Road., Atlanta, GA 30322, USA. Fax: + 1 404 727 3452, Tel.: + 1 404 727 5972, E-mail: dedmond@bimcore.emory.edu Abbreviations: IPTG, isopropyl thio-b- D -galactoside; MPT, molyb- dopyranopterin monophosphate; XDH, xanthine dehydrogenase; XDH AB , recombinant XDH expressed in Escherichia coli NI453 (without xdhC); XDH ABC , recombinant XDH expressed in Escherichia coli NI850 (with xdhC); XO, xanthine oxidase. Enzymes: xanthine dehydrogenase (E.C. 1.1.1.204) and xanthine oxidase (E.C. 1.1.3.22); Comamonas acidovorans XdhA (Q8RLC1) and XdhB (Q8RLC0); Bos taurus XDH (P80457); Rhodobacter capsulatus XdhA (O54050) and XdhB (O54051); Rhodobacter capsul- atus molybdopterin cofactor insertase XdhC (Q9 · 7K2); Pseudo- monas aeruginosa XdhA (Q9I3I9), XdhB (Q9I3J0) and XdhC (E83456); Escherichia coli putative molybdenum cofactor sulfurase ycbX (P75863); Escherichia coli putative molybdenum cofactor inser- tase yqeB (Q46808); Escherichia coli Elongation Factor EF-Tu (P02990). Note: nucleotide sequence data are available in the GenBank database under the accession number AY082333 Version: 11 August, 2003. (Received 11 August 2003, accepted 9 October 2003) Eur. J. Biochem. 270, 4744–4754 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03875.x nonfunctional demolybdo form. Attempts to express the recombinant rat enzyme in the baculovirus system [8,9] were reported to produce  10% functional enzyme at low expression levels. Expression of Drosphila melanogaster XDH in Emericella nidulans [10] produced similar results, yielding unstable recombinant enzyme with low activity. Homologous expression of D. melanogaster XDH mutants in D. melanogaster produced minimal levels of the enzyme (< 10% of native) [11,12]. Given the complexity of the MPT center in XDH, it is not surprising that expression of a fully functional enzyme has remained a formidable chal- lenge. Successes have been achieved in the expression of the molybdopyranopterin enzymes sulfite oxidase and dimethyl- sulfoxide reductase in Escherichia coli [13,14]. These Mo containing enzymes do not have the complication of the terminal sulfur ligand on the Mo center as a requirement for activity. However, the successful expression of these enzymes in E. coli suggests the potential for success in expressing a recombinant XDH in this organism. Expression of XDH requires the incorporation of the MPT center, placement of the terminal sulfur ligand on the Mo, and the incorporation of two [2Fe)2S] centers and an FAD into the recombinant enzyme. Therefore, the host organism has to be able to provide these cofactors and the means for their incorporation into the expressed protein in order to form an active enzyme. Proteins functioning in the sulfuration of the molybdo- pyranopterin cofactor have been identified in D. melano- gaster [15,16], Homo sapiens [17], B. taurus [18], Arabidopsis thaliana [19], and E. nidulans [16], and are homologous to prokaryotic NifS-like proteins, which are involved in Fe–S cluster biogenesis [20]. A similar protein, ycbX,alsoexistsinE. coli [16], suggesting that this bacterium has the machinery to sulfurate the MPT in a recombinant XDH. Genes similar to the recently identified R. capsulatus xdhC (which encodes a 33 kDa protein with proposed function of either a MPT chaperon or a MPT insertase) [21] have also been identified in a number of other prokaryotes (Fig. 1), including a weakly homologous gene, yqeB,intheE. coli genome. However, no apparent homologues in eukaryotes have been observed. Previous work from this laboratory has shown that the XDH isolated from Comamonas acidovorans exhibits the same cofactor content and many spectral and kinetic properties similar to those of the eukaryotic enzymes [22]. Rather than an a 2 homodimer of  300 kDa, as observed in eukaryotes, the bacterial enzyme is an a 2 b 2 heterotetramer of subunits exhibiting molecular mass values of  60 kDa (b-subunit) and  90 kDa (a-subunit). As a good deal of information is available in the literature on the C. acidovo- rans XDH, attempts of its expression appeared to be a worthwhile effort which, if successful, would provide a system permitting the use of site-directed mutagenesis to probe the functional roles of amino acid residues implicated in the catalytic mechanism of this class of enzymes. In this article we describe the sequencing, cloning and conditions required for the high-level expression of func- tional recombinant C. acidovorans XDH in E. coli.Itis shown that coexpression of the Pseudimonas aeruginosa xdhC gene is required for stoichiometric MPT incorpor- ation into the recombinant protein and for expression of fully functional enzyme. While this manuscript was under review, Leimkuhler et al. [23] reported the successful expression of R. capsulatus XDH in E. coli. The similarities and differences of the results of their studies with those reported here are discussed. Materials and methods Reagents, strains and vectors All reagents and medium components were purchased either from Sigma-Aldrich Co. or from Fisher Scientific Co. E. coli JM109(DE3) was a epst from M. W. Adams (University of Georgia, Athens, GA, USA). E. coli strains TOP10 (Invi- trogen Inc., Carlsbad, CA, USA), XL-1-Blue or XL10-Gold (Stratagene Inc., La Jolla, CA, USA) were used for routine transformations. Vectors pGEM-5Zf(+) (Promega Co., Madison, WI, USA) and pCR2.1 (Invitrogen) were used for routine cloning, and vector pET23a(+) (Novagen Inc., Madison, WI, USA) was used as the expression vector. C. acidovorans (ATCC 15667) was maintained on minimal medium plates, as described previously [22]. DNA purification and manipulation C. acidovorans plasmid preparations were performed using a combination of cell lysis with SDS and equilibrium centri- fugation in CsCl/ethidium bromide gradients [24]. Purifica- tion of cloning and expression vectors for use in DNA sequencing was performedusing the QIAprep Spin Miniprep kit (Qiagen Inc., Valencia, CA, USA). All DNA manipula- tions were carried out using standard protocols [24]. LASERGENE software (DNAstar Inc., Madison, WI, USA) was used for sequence manipulation and assembly, BLAST (NCBI, http://www.ncbi.nlm.nih.gov:80/BLAST/) was used to identify gene homologies, and the Windows version of CLUSTAL X (NCBI) and BOXSHADE (Swiss Institute of Bioinformatics, http://www.ch.embnet.org/software/ BOX_form.html) were used to generate multiple protein sequence alignments. Promoter regions were predicted using the NNPP server (http://www.fruitfly.org/seq_tools/ promoter.html). Fig. 1. Gene organization of several sequenced prokaryotic XDH. Most prokaryotic xdh operons contain the xdhC gene, encoding a molyb- dopterin cofactor insertase, located downstream of the xdhAB genes. The known exceptions are Berkholdaria mallei and Berkhol- daria pseudomallei. In these organisms, the xdhC gene is either absent or located elsewhere in the genome. C. acidovorans, Comamonas acidovorans; P. aeruginosa, Pseudomonas aeruginosa; R. capsulatus, Rhodobacter capsulatus; E. coli, Escherichia coli. Ó FEBS 2003 Influence of xdhC on functional XDH expression (Eur. J. Biochem. 270) 4745 Peptide sequences of XDH Large-scale fermentations (200 L) of C. acidovorans were performed at the University of Georgia Fermentation Facility. Enzyme purification from frozen cell paste was performed using a simplified method, described previously by Xiang & Edmondson [22]. N-terminal sequence analysis was obtained by automated Edman degradation of purified XDH blotted onto poly(vinylidene difluoride) membranes, or of peptides iso- lated by HPLC at the Emory University Microchemical Facility using an Applied Biosystems 494cLC Protein Sequencer. A ReflexIII MALDI-TOF (Bruker Daltonics, Billarica, MA, USA) and API3000 triplequadruple (Applied Biosystems, Foster City, CA, USA) mass spectrometers were also used for peptide sequence determination. Gel electrophoresis SDS/PAGE and native PAGE gels [25] were used to confirm the identity of recombinant proteins. Western blot analysis was performed using rabbit polyclonal antisera raised against C. acidovorans XDH, as described previously [22]. Proteins were detected by staining with Coomassie Brilliant Blue (Sigma), or by activity staining in the presence of xanthine/Nitro Blue tetrazolium [26]. Low molecular weight SDS/PAGE standards (Bio-Rad Laboratory Inc., Hercules, CA, USA) and a 1 kb ladder (Promega) were used, respectively, as protein and DNA standards. Cloning and sequencing of the C. acidovorans xdh genes by PCR Eleven polypeptides, sequences of which were obtained by Edman degradation of C. acidovorans XDH peptides and are shown in the multiple alignments (Fig. 2), were chosen to produce degenerate primers. DNA sequencing and DNA synthesis were performed at the Emory University Micro- chemical Facility. The degenerate primers were used in a stepdown PCR method, described previously [27], together with 2.6% dimethylsulfoxide and 1 M betaine as additives. The PCR products were extracted using the MinElute Gel Extraction kit (Qiagen), ligated and then transformed into E. coli TOP10 competent cells according to the TOPO TA cloning kit (Invitrogen) manual. The required clones were identified by digestion with EcoRI, sequencing and assembly into a continuous sequence. To extend the sequence from both ends, random primers were generated based on the repeti- tion frequency of all octamers in the sequenced portion of the C. acidovorans xdh operon using the program OPTFREQ , written in this laboratory in ANSI C and available from the authors upon request. Four of the highest frequency octamers (gcaaggcc, cgagctgg, gtggcgca, gcctgcat), with a GC content close to that of the C. acidovorans genome (68%), were used to generate 3¢ termini of the PCR primers. The 5¢ termini of the PCR primers were synthesized at equal nucleotide concentrations. The second primer was derived either from the known 5¢ end of the xdhA gene (ggcaggaattgaatgcag) or the known 3¢ end of the xdhB gene (gcccagtacctacaagattc). Localization of xdhAB genes on the C. acidovorans plasmid was established using the AlkPhos Direct System with the 360 bp probe generated by PCR from the forward (5¢-tccatcattcatgacgacc) and reverse (5¢-atgtacggctccgtcttcct) primers and C. acidovorans plasmid DNA as a template. Activity and protein assays XDH activity was measured spectrophotometrically by monitoring the production of uric acid at 295 nm (e 295 ¼ 9600 M )1 Æcm )1 ) in activity buffer (100 m M Tris/ HCl, 1 m M EDTA, 0.6 m M xanthine and 2 m M NAD + , pH 7.8) at 25 °C. One unit of XDH activity is defined as the amount of enzyme catalyzing the production of 1 lmol of uric acid per minute at 25 °C. The Biuret [28] or the Bearden [29] assays were used to estimate protein concentration. The protein concentrations of purified enzyme samples were determined by measuring the absorption at 450 nm (e 450 ¼ 37 000 M )1 Æcm )1 ). The level of functional enzyme refers to XDH species containing a functional Mo catalytic center. The functionality is estimated as a ratio of change in the absorbance at 450 nm after anaerobic reduction of the enzyme with 1 m M xanthine relative to the absorption change after reduction by dithionite. Expression of recombinant C. acidovorans XDH AB in E. coli The xdhAB genes, containing coding sequences for both a-andb-subunits of C. acidovorans XDH, were amplified Fig. 2. Location of the xdhAB gene operon on an isolated Coma- monas acidovorans plasmid. Agarose gel (A) and Southern blot (B) analyses of 0.3 lgofpurifiedintactC. acidovorans plasmid (lane 2) and of 0.3 lgofplasmiddigestedwithSacII (lane 3). Lane 1 contains 0.5 lg of a 1 kb DNA ladder standard. The Southern blot was developed using a 360 bp probe, as described in the Materials and methods. Besides being a DNA size marker, lane 1 serves as a negative control, showing that the probe is specific for xdhAB genes. Lane 2 demonstrates that the probe highlights the band corresponding to the C. acidovorans plasmid. Lane 3 of the gel (A) shows that after incu- bation of the plasmid with SacII, it becomes completely digested; however, on the blot (B) it remains as a sharp band of lower molecular size. Lane 4 shows the effect of double digestion of 0.3 lgofC. acido- vorans plasmid with NdeI/SacII, which corresponds to a fragment of the plasmid containing the xdhAB gene. 4746 N. V. Ivanov et al. (Eur. J. Biochem. 270) Ó FEBS 2003 using stepdown PCR [27] mediated by the forward primer xb101+ (5¢-gccgcccatatgcaccaccaccaccaccacagcaccagtca gaactct), the reverse primer xa100– (5¢-gtggtgaattcagc cagtgtgcccttg), and pNIall2 as a template. To facilitate purification of recombinant enzyme, the xb101+ primer incorporates an encoded hexahistidine tag into the 5¢ end of the xdhA gene. The reaction product of 4.2 kb was purified and ligated into a pET23a(+) vector, producing the pNI453 expression vector. Correctness of the construct was demonstrated by DNA sequencing. The expression construct, pNI453, was introduced into E. coli JM109(DE3) using electroporation (400 lLcuvettes, 2 mm gap, 2500 V,  5 ms), according to the manufac- turer’s manual. The resulting E. coli strain, NI453, was cultured overnight (16 h), at 21 °C in LBANG media (Luria–Bertani medium supplemented with 100 mgÆL )1 ampicillin, 1 m M guanosine and 0.25 m M sodium molyb- date), without isopropyl thio-b- D -galactoside (IPTG) induc- tion. For large-scale preparations, two 12-L fermenters (New Brunswick Scientific, Edison, NJ, USA) were used for overnight culture (16 h) of E. coli NI453 at a stirring rate of 400 r.p.m. with an airflow of either 6 LÆmin )1 for low aerated preparations or 12 LÆmin )1 for highly aerated preparations. The cells collected by centrifugation were stored at )80 °C. Preparation and expression of XDH ABC , containing the gene encoding P. aeruginosa xdhC ,in E. coli NI850 The xdhC gene (PA1522) was amplified from genomic DNA of P. aeruginosa PAO1-LAC, via stepdown PCR, using forward xc1+ (ctgaacaagcttgatcgggaggatgacgag) and reverse xc1e– (gcggggctcgagtcaggattcgtgggcgc) primers. The PCR product was digested with HindIII/XhoI, purified, ligated with T4 ligase into plasmid pNI453 and transformed into E. coli JM109(DE3) by electroporation. Clones con- taining the correct inserts were identified by restriction digests with HindIII/XhoI and by DNA sequencing. The growth of E. coli NI850 was performed under conditions similar to those described for E. coli NI453, except that high aeration was achieved at 6 LÆmin )1 and low aeration at 2LÆmin )1 airflow in a 10 L BIOFLO 3000 bioreactor (New Brunswick Scientific). Purification of recombinant XDH AB and XDH ABC Cell pastes of E. coli strains NI453 and NI850, cultured as described above, were resuspended in three volumes of buffer A (50 m M KH 2 PO 4 ,1m M EDTA, 2 m M 2-merca- ptoethanol, pH 7.8) and disrupted using a combination of lysozyme treatment (0.1 mgÆmL )1 lysozyme incubated at 37 °C for 20 min) and sonication (five 1 min intervals at an 80% power level of 550 Watts). The cell extract was clarified by centrifugation at 45 000 g for 30 min, mixed with 0.8 volumes of DE-52 resin and packed onto a column of 0.4 volumes of fresh DE-52 in a batch manner. The column was washed with buffer A until the absorbance at 280 nm (A 280 ) was lower than 0.1; the washing buffer was then replaced with buffer B (50 m M KH 2 PO 4 ,2m M 2-mercaptoethanol, pH 7.8). After washing with five column volumes, the protein was eluted with a salt gradient (0–1 M NaCl) in buffer B. Fractions containing catalytic activity were pooled and applied directly to a Ni 2+ bound Talon column. To remove nonspecifically bound proteins, the Talon column was washed with buffer C (50 m M KH 2 PO 4 , 300 m M NaCl, 5 m M imidazole, 2 m M 2-mercaptoethanol, pH 7.8) until the A 280 was lower than 0.03. Bound material was eluted with buffer D (50 m M KH 2 PO 4 ,300m M NaCl, 150 m M imidazole, 2 m M 2-mercaptoethanol, pH 7.8). The active fractions were pooled, concentrated by ultrafiltration in an Amicon concentration unit (Millipore, Billerica, MA, USA), and chromatographed on a Sephacryl S-300 (Amer- sham Biosciences) gel filtration column equilibrated with buffer E (50 m M Hepes, 1 m M EDTA, 2 m M 2-mercapto- ethanol, pH 7.8), to exchange the buffers from D to E, concentrated by ultrafiltration and stored at )80 °C. The recombinant enzymes purified from E. coli strains NI453 and NI850 were named XDH AB and XDH ABC , respect- ively, Protein characterization UV/Vis spectra were measured using a Lambda 2 spectro- meter (Perkin-Elmer) at 25 °C using buffer E as a reference. CD spectra were recorded in 10 mm path length cells on an AVIV 62DS spectrometer. EPR spectral data were recorded using a Bruker ER-200D spectrometer equipped with an Oxford Instruments cryogenic system for liquid He temperatures. Metal and cofactor analysis Prior to the metal and cofactor analysis, protein solutions were passed through a small Chelex-100 column to remove all adventitious metals. Mo analysis was performed using the dithiol method [30], while iron analysis was performed by using the modified ferrozine complex method [31]. Metal analysis of the recombinant protein samples were also performed using Thermo Jarrel-Ash965 inductively coupled argon plasma spectroscopy at the Chemical Analysis Laboratory, University of Georgia. The flavin content of recombinant protein samples was measured by UV/Vis absorption spectra after acid precipitation of the protein [32]. GenBank accession number The DNA sequences of xdhAB, xprA and ssuACB are available in GenBank (accession number AY082333). Results Gene localization and sequence The observation of a naturally occurring plasmid as part of the C. acidovorans genomic DNA [26] raised the question of location of the xdhAB operon. The plasmid size is estimated to be 24 kb, by comparison to the mobility of a supercoiled DNA standard on electrophoresis (data not shown). Agarose gel (Fig. 2A) and Southern blot (Fig. 2B) analyses of the intact and of SacII digested C. acidovorans plasmid DNA provide direct evidence that the xdhAB genes are located on the plasmid. Ó FEBS 2003 Influence of xdhC on functional XDH expression (Eur. J. Biochem. 270) 4747 Amino acid sequences obtained by Edman degradation of tryptic or Lys-C generated peptides of purified C. acidovo- rans XDHwereusedtodesignprimersaccordingtothe alignment of the peptide sequences with B. taurus, D. mel- anogaster,andR. norvegicus XDHs (Figs 3 and 4). The stepdown PCR, with addition of dimethylsulfoxide and betaine, was used to overcome the high GC content ( 68%) typical of the Comamonas genus. The resulting sequence assembled from sequencing reads of the PCR clones covered both xdhAB genes separated by one adeno- sine nucleotide, as determined from the alignment of N- and C-terminal protein sequences from both subunits; their translated amino acid sequences are shown in Figs 3 and 4. All peptide sequences (Figs 3 and 4), identified by Edman degradation, and by MALDI and ESI mass matching, were located on the protein sequence that corresponded to the xdhAB nucleotide sequence. According to the sequence obtained, the b-subunit contains 535 amino acids with a calculated average molecular mass of 57 752 Da and the a-subunit contains 808 amino acids with a calculated average molecular mass of 87 392 Da. The total calculated average molecular mass of the heterotetrameric (a 2 b 2 ) protein is 290 298 Da. Electrospray MS of purified C. acidovorans XDH showed the a-subunit mass to be 87 427 ± 30 Da and the b-subunit mass to be 57 774 ± 15 Da (data not shown). The differences between the observed and calcula- ted masses, 35 Da for the a-subunit and 22 Da for the b-subunit, are within the experimental error of the instru- ment. These data also demonstrate that the enzyme does not contain any detectable post-translational modifications. Four additional genes, with homologs in P. aeruginosa and E. coli genomes, encoding putative xanthine/uracil permease (xprA) and three subunits of the putative sulfo- nate ATP-binding cassette transporter (ssuACB), were identified by extension of the 3¢ terminal sequence of the xdhAB genes. None of these genes were similar, at the protein level, to the xdhC gene, which is a member of the majority of bacterial xdh operons (Fig. 1). Prediction of a prokaryotic promoter in front of xdhA andinfront of ssuA suggests that xprA is cotranscribed with xdhAB genes as a single operon. The presence of a predicted Shine– Dalgarno motif for xdhB in front of the xdhA stop codon implies translational coupling between the two subunits. A similar relationship is observed between xdhABC genes in P. aeruginosa and R. capsulatus. Expression of recombinant C. acidovorans XDH AB and XDH ABC in E. coli Optimal expression levels of the functional enzyme XDH AB in E. coli requires the presence of 0.25 m M Na 2 MoO 4 and 1m M guanosine in the media, no IPTG induction, and a low (6 LÆmin )1 ) air supply. Guanosine is added because it is a known precursor in the biosynthesis of the MPT cofactor and is permeable to the cell. Induction of XDH AB expression with IPTG concentrations ranging from 0 to 1m M results in decreased specific activities in cellular extracts. The influence of aeration levels on XDH functionality was tested because the enzyme catalyzing sulfuration of the Fig. 3. Sequence alignment for the small subunit (xdhA). The sequence of the small subunit of Comamonas acidovorans was aligned with those of the XDHs from Bos taurus [38] and Rhodobacter capsulatus [3]. XDH peptides identified by Edman degradation (solid arrows), or by MALDI or ESI mass matching (dotted arrows), are indicated. The peptides used to generate PCR primers are underlined with double arrows. 4748 N. V. Ivanov et al. (Eur. J. Biochem. 270) Ó FEBS 2003 Mo cofactor has been shown to utilize cysteine as the source of sulfur [19]. Therefore, the level of sulfuration of recombinant XDH may be influenced by the redox state of the thiols in the cell. Indeed, the level of XDH AB activity observed in crude cell extracts was  60-fold higher in cell cultures grown with a lower level of aeration (6 L of air min )1 ) than that observed with a higher level of aeration (12 L of air min )1 )(Table1). Under optimal conditions, functional XDH AB was observed at a level (0.25 UÆmg )1 of total protein and 2.16 mg of enzyme L )1 of culture) comparable to that produced by C. acidovorans grown on minimal media containing hypoxanthine (0.46 UÆmg )1 and 1.87 mgÆL )1 ) [22] and lower relative to the reported expression of R. capsulatus XDH ABC in E. coli (12.5 mgÆL )1 )[23].As we were unable to isolate xdhC from C. acidovorans,agene encoding xdhC was cloned from P. aeruginosa. Its coex- pression within the xdhABC expression construct resulted in the expression (2.28 UÆmg )1 and 8.04 mgÆL )1 ) of functional C. acidovorans XDH ABC in E. coli cellular extracts. It also showed that the xdhC gene product is active in the assembly of an XDH from a different bacterial species. In contrast to the results obtained with the expression of XDH AB in E. coli (see above), the level of culture aeration had no influence on the level of expression of observed XDH ABC activity. Purification and characterization of XDH AB and XDH ABC XDH AB and XDH ABC were purified, as described in the Materials and methods, and visualized on Western blots (Fig. 5A), confirming the cross-reactivity with antisera raised against C. acidovorans XDH. Activity staining with xanthine/Nitro Blue tetrazolium of native gels containing equal levels of activity (10 lU) of recombinant and native enzymes showed no detectable difference in the mobility of intact functional enzyme (Fig. 5B). All expressed enzyme samples migrated as a single band on native PAGE and as two bands on the denaturing gels (Figs 5A and 4C), Fig. 4. Sequence alignment for the large subunit (xdhB). The sequence of the large subunit of Comamonas acidovorans was aligned with those of the XDHs from Bos taurus [38] and Rhodobacter capsulatus [3]. XDH peptides identified by Edman degradation (solid arrows), or by MALDI or ESI mass matching (dotted arrows), are indicated. The peptides used to generate PCR primers are underlined with double arrows. Ó FEBS 2003 Influence of xdhC on functional XDH expression (Eur. J. Biochem. 270) 4749 corresponding to the two subunits of  60 and  90 kDa, respectively. Although Western blot analysis showed that both XDH subunits are expressed at comparable levels, the expression levels of neither the XDH subunits nor XdhC were sufficiently high to be detected in crude cellular extracts by staining with Coomassie Brilliant blue (data not shown). SDS/PAGE gels (Fig. 5C) of purified XDH AB and XDH ABC showed a co-purified third band at  40 kDa (the band is very insubstantial in the XDH AB preparation). MALDI-TOF MS analysis identified this protein to be the E. coli elongation factor EF-Tu (43 kDa). The presence of EF-Tu in the XDH preparation is not expected to affect any of the kinetic parameters, or spectral or physical properties of the purified enzyme, because the XDH concentration is calculated based on the absorbance at 450 nm contributed by the [2Fe)2S] centers and the FAD cofactor. The specific activity of the purified XDH AB grown under conditions of high aeration was 67-fold lower than that grown under conditions of low aeration (Table 1). Both enzyme preparations contained the appropriate levels of Fe–S and FAD cofactors, as judged by their respective visible absorption spectra (Fig. 6) and by metal and flavin analyses. Both preparations contained low levels of Mo Table 1. Effect of culture aeration on the functionality and cofactor content of pure recombinant Comamonas acidovorans xanthine dehydrogenase (XDH) expressed in Escherichia coli NI453 (XDH AB ) and NI850 (XDH ABC ). Property XDH AB XDH AB XDH ABC XDH ABC C. acidovorans preparation [22] Low aeration High aeration Low aeration High aeration Specific activity, UÆmg )1 11.18 0.1673 46 70 50.00 Functionality, % 15 0–1 78 93 90–100 A 280 : A 450 ratio 8.4 6.1 11.2 8.2 5.5 FAD:ab a 1.0 1.1 1.2 1.2 1.0 Fe:ab a 3.5 3.9 2.9 2.7 3.9 Mo:ab a 0.11 0.16 1.1 1.1 1.1 k cat ,s )1a 27 ± 1 0.4 ± 1 118 ± 1 179 ± 4 120 ± 3 K m xanthine, l M 66 ± 3 67 ± 2 85 ± 2 86 ± 5 68 ± 5 K m NAD + , l M 148 ± 4 156 ± 4 100 ± 5 113 ± 8 163 ± 3 a Based on the moles of ab protomer determined from the absorption at 450 nm and e 450 ¼ 37 000 M )1 Æcm )1 . Fig. 5. Electrophoretic characterization of recombinant XDH. Western blot analysis (A) with 0.25 lg of protein loaded per lane, (B) native PAGE activity staining with 10 lU of enzyme, and (C) a Coomassie Brilliant blue-stained SDS/PAGE gel with 5 lg of protein loaded per lane, compares purified XDH AB (lane 1), XDH ABC (lane 2) and native Comamonas acidovorans XDH (lane 3). The third band of  40 kDa observed in C is identified as Escherichia coli EF-Tu and is copurified in both recombinant preparations (more clearly visible in the XDH ABC preparation). Fig. 6. UV/Vis absorption spectra of pure enzymes. (A) Native Com- amonas acidovorans xanthine dehydrogenase (XDH), (B) recombinant XDH AB purified from Escherichia coli NI453 expressed at low aer- ation, (C) recombinant XDH AB purified from E. coli NI453 expressed at high aeration and (D) the enzyme XDH ABC isolated from E. coli NI850 expressing the xdhABC construct (similar for either aeration). The absorption spectra have been offset from one another for clarity of presentation. 4750 N. V. Ivanov et al. (Eur. J. Biochem. 270) Ó FEBS 2003 (10–15% of a stoichiometric level). Therefore, the similar- ities of metal and flavin content for both preparations suggest that the difference in activity is directly linked to the difference in the level of sulfuration of their respective MPT centers. We estimate that the enzyme preparation purified from cells grown under aeration conditions of 6 L of air per min has all of its Mo centers in an active, sulfurated form, whereas the enzyme purified from cells grown under aeration of 12 L of air per min has less than 2% of its Mo centers in an active, sulfurated form. It was previously shown that R. capsulatus xdhC is required for efficient incorporation of MPT into R. capsul- atus XDH [21]. Similarly, it appears that the coexpression of xdhC with the xdhAB genes is required for the expression of functional recombinant C. acidovorans XDH (termed XDH ABC ) with a stoichiometric level of MPT. Growth of this strain under aeration at 6 LÆmin )1 , and purification of the expressed XDH ABC , resulted in an enzyme preparation with a stoichiometric quantity of MPT (Table 1) as well as of FAD and Fe–S centers and a level of functionality approaching 100%. Growth of the E. coli cultures under different aeration conditions did not significantly affect the functionality of the recombinant XDH ABC (Table 1). These results provide direct evidence that the gene product of xdhC functions in E. coli as either MPT or Mo insertase, as suggested previously, by the work of Leimkuh- ler et al.[21],onR. capsulatus XDH expressed in R. cap- sulatus. The protein product of xdhC appears to exhibit a redox role in maturation of the XDH ABC by eliminating the dependence of its functional expression on the redox state of the cell (Table 1). These data also show that P. aeruginosa xdhC is able to participate in assembly of the C. acidovorans XDH in E. coli. The steady state kinetic properties of the purified recombinant C. acidovorans XDH ABC are essentially iden- tical (Table 1) to those determined previously for the naturally occurring enzyme [22]. Therefore, the recombinant enzyme appears to be functionally identical to the native enzyme. Spectroscopic studies of purified XDH AB and XDH ABC The UV/Vis spectrum of recombinant C. acidovorans XDH AB (Fig. 6), purified from a 6 LÆmin )1 aeration preparation of E. coli NI453, is very similar to the spectrum of native enzyme in either an oxidized (as isolated) or a reduced (with 0.6 m M xanthine) state. In a range of 300–500 nm, the Fe–S clusters exhibit spectral properties typical of a [2Fe)2S] ferredoxin absorption maxima (315, 420, and 467 nm), which overlap with FAD absorption maxima at 370 and 450 nm [33]. As observed with bovine and native C. acidovorans XDHs, the absorbance in the 300–500 nm range is bleached upon addition of 1 m M xanthine owing to reduction of the Fe–S and FAD centers, and it is reduced even further upon addition of dithionite crystals, indicating that the enzyme exhibits  15% func- tionality (Table 1). Similarities of the oxidized and reduced absorption spectra of the recombinant XDH, with those of the native XDH and of bovine XDH, are consistent with the metal and flavin analysis data (Table 1) and demonstrate the presence of two nonidentical [2Fe)2S] iron–sulfur centers and an FAD cofactor. The identity of the two [2Fe)2S] iron–sulfur clusters was further confirmed by CD (Fig. 7) and EPR (Fig. 8) spectroscopies. Previous data in the literature have reported that the visible CD spectrum of bovine milk XO is dominated by contributions from the two [2Fe)2S] centers [33], a property also exhibited by C. acidovorans XDH [22]. Figure 7 shows the visible CD spectra of the recombinant XDH AB in its oxidized form, after reduction with xanthine, and after reduction with dithionite. The overall shape of the oxidized spectrum was identical to that of native C. acido- vorans XDH and similar to that published [34] for bovine milk XO, showing a characteristic positive band with a maximum at 430–440 nm and two negative bands with maxima at 370–380 nm and at 560–570 nm. Similar CD spectra were obtained for purified preparations of XDH AB (grown at low aeration) and with XDH ABC (independent of the culture aeration level). The level of reduction by xanthine was higher than expected from the level of functionality (15%), owing to the reduction of non- functional enzyme by functional XDH in the time required for collection of six CD scans. These spectral data further support the fact that recombinant XDH contains [2Fe)2S] clusters identical to those in the naturally occurring enzyme. Low temperature EPR spectra of reduced samples of purified recombinant preparations (Fig. 8), taken at 10 K and 70 K, demonstrate the presence of [2Fe)2S] I and the fast-relaxing [2Fe)2S] II (observed at temperatures lower than 20 K) in both forms of recombinant enzyme (XDH AB and XDH ABC ). Thus, the incorporation of these two Fe–S clusters within the enzyme is independent of the coexpres- sion of xdhC. The EPR spectrum of XDH ABC at 70K shows Fig. 7. CD spectra of recombinant xanthine dehydrogenase (XDH) AB (low aeration) in oxidized (solid line), xanthine reduced (dashed line) and dithionite reduced (dotted line) states. TheCDspectrumforXDH ABC was identical (only one for the oxidized form is shown, in large dots). Upon addition of xanthine, the reduction was incomplete, as seen by the further reduction with dithionite, and indicates the presence of nonfunctional enzyme. The level of reduction by xanthine was higher than expected from the level of functionality, as a result of the reduction of nonfunctional enzyme by functional XDH in the time required for collection of six CD scans. Conditions: 22.89 l M of XDH AB (low aeration) and 5.4 l M of XDH ABC (low aeration) in 50 m M Hepes, 1 m M Tris,pH 7.8,25°C. Excess 1 m M xanthine and a few crystals of dithionite were used for reduction. Ó FEBS 2003 Influence of xdhC on functional XDH expression (Eur. J. Biochem. 270) 4751 asignalat 349 mT caused by Mo(V), which is not apparent in the spectrum of XDH AB at 60K because the Mo content is  10-fold lower. Discussion Our knowledge of the structure and function of Mo-dependent enzymes has increased dramatically over the past several years as a result of successes in the structural elucidation of a number of enzymes in this class by X-ray crystallography. This structural information can be exploi- ted to use site-directed mutagenesis, in a detailed manner, as additional probes of enzyme structure and mechanism. The complexity of the molybdopyranopterin site (the catalytic site for most of the enzymes in this class) adds further difficulty in the successful expression of molybdoenzymes in the xanthine oxidoreductase family. The most important factor involved in producing a functional MPT center in recombinant XDH, using the E. coli expression system, is the coexpression of xdhC (thought to be an MPT insertase [21]). Failure to coexpress this protein leads to a recombinant enzyme preparation being highly dependent on the level of culture aeration or redox state of the cell and having a low Mo content (Table 1), consistent with the results of Leimkuhler et al. [21] on the expression of R. capsulatus XDH AB in R. cap- sulatus where xdhC was disrupted. The data presented here show that Fe–S cluster formation and FAD incorporation into the recombinant XDH do not require a functional XdhC. In contrast, Leimkuhler et al. [23] find the level of MPT in their R. capsulatus XDH preparation, expressed in E. coli, to be stoichiometric and independent of the presence of xdhC, and their data suggest that the level of MPT sulfuration is lower in the absence of xdhC than in its presence. Assuming that the level of incorporated MPT and Mo is the same in an enzyme preparation, and that the R. capsulatus XDH is very similar to C. acidovorans XDH, we suggest the following explanation for these seemingly contradictory results. Partial (10%) incorporation of molybdenum into recom- binant C. acidovorans XDH expressed in E. coli JM109(DE3) may be explained by the presence of an intrinsic E. coli Mo insertase. It is possible that a product of the E. coli gene yqeB, exhibiting weak homology to the P. aeruginosa xdhC or R. capsulatus xdhC, can perform this function with a broad specificity for MPT and MGD cofactors. However, as the majority of MPT produced by E. coli JM109(DE3) is converted to MGD by MGD synthase [35], only a small amount of MPT is available for incorporation into the expressed apoprotein. On the other hand, E. coli TP1000, used for the expression of R. capsulatus XDH [23], carries a disrupted MGD synthase and produces MPT as a final product of the cofactor biosynthesis, resulting in its stoichiometric incorporation into R. capsulatus XDH. From the results presented in this study, one would predict that the expression of the latter enzyme, under low culture aeration conditions, might yield a fully functional enzyme in the absence of xdhC.Alternat- ively, the intrinsic E. coli Mo insertase may have a lower insertase activity with the heterologously expressed C. acidovorans XDHthanwiththeR. capsulatus enzyme. The co-expression of P. aeruginosa xdhC with C. acido- vorans xdhAB,orR. capsulatus xdhC with R. capsulatus xdhAB, results in the production of enzymes with stoichio- metric levels of MPT, independently of E. coli or of aeration Fig. 8. EPR spectra of dithionite reduced recombinant Comamonas acidovorans xanthine dehydrogenase (XDH) AB (low aeration) and XDH ABC preparations. All spectra were calculated as an average of four or five scans to reduce the signal-to-noise ratio. The xanthine reduced spectrum for XDH AB wasveryweakasonlyasmallfraction of [2Fe)2S] centers were reduced by the substrate. Xanthine-reduced spectra for XDH ABC were similar in shape and intensity to the dithionite-reduced spectrum (data not shown), as the enzyme is fully functional. The molybdenum signal at 349 mT was more prominent in XDH ABC (at70K)comparedwiththeXDH AB preparations . (A) The spectra were taken at 12 K (top) and 60 K (bottom). The enzyme concentration was 81.7 l M in buffer E; microwave frequency 9.65 GHz; microwave power 0.2 mW; modulation frequency 100 KHz; receiver gain 2 · 10 4 ; modulation amplitude 1 mT. (B) The spectra were taken at 10 K (top) and 70 K (bottom). The enzyme concentration was 70 l M in buffer E; microwave frequency 9.66 GHz; microwave power 0.2 mW; modulation frequency 100 KHz; receiver gain 2 · 10 4 ; modulation amplitude 1 mT. 4752 N. V. Ivanov et al. (Eur. J. Biochem. 270) Ó FEBS 2003 levels, indicating that XdhC is specific for MPT insertion. It remains for future work to delineate the detailed function and mechanism of the xdhC gene product in MPT insertion into the molybdoenzymes. The finding that XDH AB activity levels are dependent on the level of culture aeration suggests that, in the absence of XdhC, the incorporation of the terminal sulfur ligand into the Mo center is dependent on the redox state of the cell [23]. Our functionality data suggest that at a lower culture aeration level, all the molybdenum present in the XDH AB preparation is sulfurated by an E. coli sulfurase, which may be different from the E. coli MPT insertase and which has a function that is redox state dependent. A multitude of information has accumulated over the past few years to demonstrate that the enzyme catalyzing this reaction contains pyridoxal phosphate and provisions for a persulfide bond formation [16]. Appar- ently, this enzyme is present in E. coli and is functional with the heterologously expressed XDH. Current evidence supports the source of the sulfur moiety to be free cysteine and that it is required to be in the reduced form to be an effective sulfur donor [19]. We propose the following explanation for the effect of the level of culture aeration on the expression of recombinant protein. Raising the cellular redox potential by increasing aeration levels is expected to reduce the level of cysteine and increase the level of cystine in the cell, thus reducing the availability of a sulfur donor for the sulfuration reaction producing active XDH. This would explain the dependence of activity levels of XDH AB observed on culture aeration. How the presence of XdhC protects against this effect remains to be established, but does suggest a redox role for this protein in addition to its insertase function. It is of interest that expression of the MPT-dependent enzyme rat liver sulfite oxidase in E. coli [36] does not require the coexpression of an MPT insertase, as there was no mention of a dependence of the level of culture aeration in the expression of recombinants. These results, together with the results presented in the current report, demon- strate that the incorporation of MPT into XDH is a more complex process than the incorporation of MPT into sulfite oxidase. Differences have been observed in the reactivity of MPT in bovine milk XO compared with that of rat liver sulfite oxidase [37]. The authors propose that bovine XO contains MPT in the quinonoid dihydro form and that the MPT in sulfite oxidase is a different dihydro isomer. These suggested differences in the respective MPT cofactors of these two molybdoenzymes may be related to differences in requirements for MPT insertion into the apoproteins. Little is known regarding the structure or mechanism of the gene product of xdhC. It appears to be present as part of the xdh operon in a number of prokaryotes (Fig. 1). A screen of the genomic DNA library of C. acidovorans has been performed using a probe based on the consensus sequence of the xdhC genes present in other bacteria and, to date, has not been successful in identifying xdhC. Our failure to locate the xdhC gene within the xdh gene operon of C. acidovorans suggests that it resides at another location, as it appears to be essential for molybdopterin incorporation into XDH. Unfortunately, XdhC proteins are not highly conserved (P. aeruginosa and R. capsulatus XdhC proteins are only 36% identical) and not even present in the xdh operon (Fig. 1) of some bacteria. Therefore, design of an optimal probe is problematic. The sequence of C. acidovorans XDH shows a high level of identity around the molybdopterin (Fig. 9) and [2Fe)2S] centers (residues 45–56, 130–140, 170–182) with other structurally characterized XDHs, despite the lower overall similarity (43% identity/55% similarity to R. capsulatus XDH [6] and 31% identity/46% similarity to the bovine enzyme [5]). An example of this structural identity is shown in Fig. 9, where the structure around the MPT site in bovine XDH is shown and the corresponding amino acids in C. acidovorans are shown in parenthesis. The residues around the Mo site are identical. The results from this study show the development of an XDH expression system that should be beneficial for future detailed mutagenesis studies on the mechanism of the C. acidovorans recombinant enzyme with its direct applica- bility to the mechanism of the eukaryotic enzyme. Addi- tionally, this system should prove of value as a tool to explore the function of XdhC in its role of assembly of a functional MPT active site in the xanthine oxidoreductase class of enzymes. Acknowledgements This study was supported by a grant from the National Institutes of Health (GM-29433). References 1. Harrison, R. (2002) Structure and function of xanthine oxido- reductase: where are we now? Free Radic. Biol. Med. 33, 774–797. 2. Hille, R. (1996) The mononuclear molybdenum enzymes. Chem. Rev. 96, 2757–2816. 3. Leimkuhler, S., Kern, M., Solomon, P.S., McEwan, A.G., Schwarz, G., Mendel, R.R. & Klipp, W. (1998) Xanthine dehy- drogenase from the phototrophic purple bacterium Rhodo- bacter capsulatus is more similar to its eukaryotic counterparts Fig. 9. Schematic representation of the active site of the Comamo- nas acidovorans XDH Mo center. ThefigureisbasedontheBos taurus XDH structure (residues of which are shown in parenthesis) with corresponding conserved C. acidovorans XDH residues (shown in bold). Ó FEBS 2003 Influence of xdhC on functional XDH expression (Eur. J. Biochem. 270) 4753 [...]... characterization of xanthine dehydrogenase in a baculovirus-insect cell system In Flavins and Flavoproteins 1993 Proceedings of the 11th International Symposium on Flavins and Flavoproteins (Yagi, K., ed.), pp 711– 714 de Gruyter, Berlin Nishino, T., Kashima, Y., Okamoto, K., Iwasaki, T & Nishino, T (1997) The monomeric form of xanthine dehydrogenase expresses in baculovirus-insect cell system In Flavins... molybdenum cofactor insertion into xanthine dehydrogenase of Rhodobacter capsulatus J Bacteriol 181, 2745–2751 22 Xiang, Q & Edmondson, D.E (1996) Purification and characterization of a prokaryotic xanthine dehydrogenase from Comamonas acidovorans Biochemistry 35, 5441–5450 23 Leimkuhler, S., Hodson, R., George, G.N & Rajagopalan, K.V (2003) Recombinant Rhodobacter capsulatus xanthine dehydrogenase, a useful... system for the characterization of protein variants leading to xanthinuria I in humans J Biol Chem 278, 20802–20811 24 Sambrook, J., Fritsch, E.F & Maniatis, T (1989) Molecular Cloning: a Laboratory Manual, 2nd edn Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York 25 Laemmli, U.K (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4 Nature 227, 680–685... 3958–3962 Amrani, L., Primus, J., Glatigny, A. , Arcangeli, L., Scazzocchio, C & Finnerty, V (2000) Comparison of the sequences of the Aspergillus nidulans hxB and Drosophila melanogaster ma-1 genes with nifS from Azotobacter vinelandii suggests a mechanism for the insertion of the terminal sulphur atom in the molybdopterin cofactor Mol Microbiol 38, 114–125 Ichida, K., Matsumura, T., Sakuma, R., Hosoya, T... structure-based mechanism of conversion Proc Natl Acad Sci USA 97, 10723–10728 Truglio, J.J., Theis, K., Leimkuhler, S., Rappa, R., Rajagopalan, ¨ K.V & Kisker, C (2002) Crystal structures of the active and alloxanthine-inhibited forms of xanthine dehydrogenase from Rhodobacter capsulatus Structure 10, 115–125 Nishino, T., Saito, T., Amaya, Y., Kawamoto, S., Ikemi, Y & Nishino, T (1994) Overexpression and characterization... 26 Xiang, Q (1996) Comamonas acidovorans Xanthine Dehydrogenase: Phosphorylation, Catalytic, and Structural Studies Emory University, Atlanta 27 Hecker, K.H & Roux, K.H (1996) High and low annealing temperatures increase both specificity and yield in touchdown and stepdown PCR Biotechniques 20, 478–485 28 Gornall, A. G., Bardawill, C.J & David, M.M (1949) Determination of serum proteins by means of the. .. (2001) ABA3 is a molybdenum cofactor sulfurase required for activation of aldehyde oxidase and xanthine dehydrogenase in Arabidopsis thaliana J Biol Chem 276, 40381–40384 20 Muhlenhoff, U & Lill, R (2000) Biogenesis of iron-sulfur proteins in eukaryotes: a novel task of mitochondria that is inherited from bacteria Biochim Biophys Acta 1459, 370–382 21 Leimkuhler, S & Klipp, W (1999) Role of XDHC in molybdenum... 222, 687–692 36 Garrett,R.M.&Rajagopalan,K.V.(1994)Molecular cloning of rat liver sulfite oxidase Expression of a eukaryotic Mo-pterin-containing enzyme in Escherichia coli J Biol Chem 269, 272–276 37 Gardlik, S & Rajagopalan, K.V (1990) The state of reduction of molybdopterin in xanthine oxidase and sulfite oxidase J Biol Chem 265, 13047–13054 38 Berglund,L.,Rasmussen,J.T.,Andersen,M.D.,Rasmussen,M.S.&... reaction J Biol Chem 177, 751–766 29 Bearden, J.C Jr (1978) Quantitation of submicrogram quantities of protein by an improved protein-dye binding assay Biochim Biophys Acta 533, 525–529 30 Cardenas, J & Mortenson, L.E (1974) Determination of molybdenum and tungsten in biological materials Anal Biochem 60, 372–381 31 Vanoni, M .A. , Edmondson, D.E., Zanetti, G & Curti, B (1992) Characterization of the. .. Escherichia coli dimethyl sulfoxide reductase operon J Bacteriol 170, 1511–1518 Temple, C .A. , Graf, T.N & Rajagopalan, K.V (2000) Optimization of expression of human sulfite oxidase and its molybdenum domain Arch Biochem Biophys 383, 281–287 Wahl, R.C., Warner, C.K., Finnerty, V & Rajagopalan, K.V (1982) Drosophila melanogaster ma-1 mutants are defective in the sulfuration of desulfo Mo hydroxylases J . Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase Nikolai V. Ivanov 1 ,. contains 808 amino acids with a calculated average molecular mass of 87 392 Da. The total calculated average molecular mass of the heterotetrameric (a 2 b 2 )