ocial integration and its association with mortality among older people in china

... Examining the association between social integration and mortality for older people in contemporary China The aim of this thesis is to examine the association between social integration and mortality ... older people in China 2.3 Social and cultural diﬀerences in the association between social integration and health for older adults Although the inconsistency in the association between social integration ... variations in the features of social integration as well as its association with health and mortality In addition, the confounding eﬀect of health in the association between social integration and mortality...

báo cáo hóa học: " Biomarkers of oxidative stress and its association with the urinary reducing capacity in bus maintenance workers" pptx

... article as: Sauvain et al.: Biomarkers of oxidative stress and its association with the urinary reducing capacity in bus maintenance workers Journal of Occupational Medicine and Toxicology 2011 ... verified by testing the correlation between levels of 8OHdG, reflecting oxidative stress, and the reducing capacity (corresponding to a defense against oxidative stress) in the urine of the particle-exposed ... oxidative stress The observed increase of reducing species in urine would mirror an increased level in blood originating from a response to oxidative stress in the body monitored by the urinary 8OHdG...

báo cáo sinh học:" Alexithymia and its association with burnout, depression and family support among Greek nursing staff" docx

... 2) Alexithymia was correlated positively with depression, emotional exhaustion and depersonalization and negatively with sense of family support and personal achievement (Table 3) Family support ... tried to interpret the associations of alexithymia with professional burnout, depressive symptoms and family support Alexithymia was directly associated with depression and personal achievement, ... studies in the Greek scientific literature, the aim of this work was to examine the associations of alexithymia with professional burnout, the perception of family support and depression in nursing...

Báo cáo y học: "Psychological quality of life and its association with academic employability skills among newlyregistered students from three European faculties" ppt

... al.: Psychological quality of life and its association with academic employability skills among newly-registered students from three European faculties BMC Psychiatry 2011 11:63 Submit your next ... study improves our understanding of the associations between the psychological quality of life, the social and environmental contexts, and the acquisition of academic employability skills among ... associated factor of quality of life in adulthood? Quality Life Research 2008, 17:249-255 Wu CH, Yao G: Examining the Relationship between global and domain measures of quality of life by three factor...

Báo cáo y học: "Epidemiological manifestations of hepatitis C virus genotypes and its association with potential risk factors among Libyan patients" pps

... epidemiology of HCV genotypes among different Libyan patients and its association with the risk factors involved and how this could be reflected on the prevention of such virus among the Libyan society ... parts of the country to estimate the diversity of HCV genotypes in each region and assess the risk factors involved with specific emphases on the genetic sequences of un-typable HCV genotypes and ... Epidemiological manifestations of hepatitis C virus genotypes and its association with potential risk factors among Libyan patients Virology Journal 2010 7:317 Submit your next manuscript to BioMed Central...

Báo cáo y học: "Walking for leisure among adults from three Brazilian cities and its association with perceived environment attributes and personal factors" pot

... Walking for leisure among adults from three Brazilian cities and its association with perceived environment attributes and personal factors Grace A O Gomes1, Rodrigo ... and little is known about walking patterns and its association with environmental features in low and middle income countries Objectives: To describe walking for leisure and to identify its association ... education level); health (perceived health, self-reported weight and height); physical activity (walking for leisure- time); and perceived environment (accessibility and safety) Body mass index (BMI)...

báo cáo hóa học:" BMP-2 signaling in ovarian cancer and its association with poor prognosis" pot

... activates SMAD 1/5/8 and Erk MAPKs in ovarian cancer cell lines To investigate the role of BMP-2 in ovarian cancer cells we selected three cell lines, TOV-2223, TOV-1946 and TOV112D, for in vitro assays ... cells of many origins including cancers arising from thyroid, androgen-dependent prostate in presence of androgen, myeloma, gastric and pancreatic cells [14,18-22] In cancer cells, BMP-2 was found ... t-test) In this study we attempted to clarify the role of BMP-2 in ovarian cancer An initial report highlighted the overexpression of BMP-2 in primary cultures of ovarian cancer cells and in the...

Báo cáo y học: "Prevalence of alexithymia and its association with anxiety and depression in a sample of Greek chronic obstructive pulmonary disease (COPD) outpatients" pptx

... [15], as well the reported associations among depression, anxiety, somatic symptoms and alexithymia [27], we studied the prevalence of alexithymia and its association with anxiety and depression in ... emotions [20-22] Although the role of alexithymia and its association with levels of anxiety and depression has already been recognised in other respiratory diseases, such as bronchial asthma [23], few ... anxiety symptoms lead to alexithymia Table 3: Prevalence of anxiety, alexithymia and depressive symptoms in relation to gender Anxiety (STAI) Alexithymia (TAS-20) Mild depression (BDI 10-14) Moderate...

Báo cáo y học: " Mitochondrial targeting of human NADH dehydrogenase (ubiquinone) flavoprotein 2 (NDUFV2) and its association with early-onset hypertrophic cardiomyopathy and encephalopathy" ppt

... targeting of human NADH dehydrogenase (ubiquinone) flavoprotein (NDUFV2) and its association with early-onset hypertrophic cardiomyopathy and encephalopathy Journal of Biomedical Science 20 11 18 :29 ... mislocalization of NDUFV2 caused by the IVS2+5_+8delGTAA mutation in NDUFV2 gene is associated with early-onset hypertrophic cardiomyopathy and encephalopathy Conclusions In conclusion, the MTS of NDUFV2 is ... mitochondrial targeting of this protein (data not shown) Establishing the human disease mechanism of the earlyonset hypertrophic cardiomyopathy and encephalopath The patients of early-onset hypertrophic...

Báo cáo y học: "Prevalence of endotoxemia after surgery and its association with ICU length of stay" potx

... Other Time ICU Hosp Alive Late 20 Y Late Y Contaminants Late Y Pseudomonas Late 24 26 Y S epidermidis Early 12 Y S aureus Early 12 Y Early 32 Y Early 19 Y Early Y Early 19 Y Pseudomonas Early 28 - ... detection Length of stay and mortality of both ICU and hospital were calculated Clinicians were unaware of the results of the EA assay throughout patient's ICU and hospital stay Endotoxin activity assay ... characterized by high levels of endotoxemia, as assessed by EA assay, despite their low level of complexity on admission High levels of endotoxin were associated with a longer ICU length of stay, particularly...

THE STUDY OF a NOVEL MIXED LINEAGE LEUKEMIA 5 ISOFORM AND ITS ASSOCIATION WITH HUMAN PAPILLOMAVIRUS 16 18 RELATED HUMAN CERVICAL CANCERS

... CGCGGATCCAATGGACTACAAAGACGATGAC GACAAGAGCATAGTGATCCCA MLL5β M5b_NotI.rev AAGGAAAAAAGCGGCCGCCAATATACGCGA GACTAGTCTT GFPMLL5β M5b_SalI.for ACGCGTCGACATGAGCATAGTGATCCCATTG M5b_BamHI.rev CGCGGATCCCAATATACGCGAGACTAGTCTT ... HPV18_7239.rev ACAACAACAACCATACATACC HPV18_ 7168 .for TGTTGTGTTTGTATGTCCTGT HPV18_7 350 .rev CCACAAACACAAATACAGTTGTT HPV18_7378.for TATTGTCCTGTATTTCAAGTTAT HPV18_ 757 6.rev CGCGCCAATTGTTCAAAATATG 2.11 Rapid amplification ... CATCTGACATATTTTCCCGCTTCCGGCGTTGT AGTAGCAC 36 GFP- M5_Y 35 8A. for AGAGGGAAGTTTATG MLL5β‐ SET mut ATTTGCCTCCTGATGCACTTATCATTGAAGCC M5_Y 35 8A. rev CATAAACTTCCCTCTGGCTTCAATGATAAGTG CATCAGGAGGCAAAT...

báo cáo khoa học: "Characterization of Sucrose transporter alleles and their association with seed yield-related traits in Brassica napus" potx

... Characterization of Sucrose transporter alleles and their association with seed yield–related traits in Brassica napus L Fupeng Li, Chaozhi Ma§, Xia Wang, Changbin Gao, Jianfeng Zhang, ... (Table 3), indicating that an increase in any of the EFB, SP, or SS traits can increase seed yield The panel lines evaluated for yield-related traits were mostly modern cultivars and breeding materials ... functioning [16] In higher plants, sugars and hormones interact and form an intricate regulatory sensing and signaling network [45], and altered sucrose levels can change the quantity of sucrose- derived...

Báo cáo y học: " The diagnostic value of serum leptin monitoring and its correlation with tumor necrosis factor-a in critically ill patients: a prospective observational study" ppt

... potassium, calcium, aspartate aminotransferase, alanine aminotransferase, prothrombin time, albumin, CRP, leptin, IL-6 and TNF -a) and arterial blood gas analysis Routine cultures of blood, urine and ... manifestations of SIRS and those with sepsis in patients suffering from a broad range of diseases in ICU and its correlation with other biomarkers Materials and methods After the study was approved by an investigational ... addition to playing a role in energy regulation, leptin also regulates endocrine and immune function It plays a role in innate and acquired immunity Both the structure of leptin and that of its receptor...

Characterizing iris surface features and their association with angle closure related traits in asian eyes

... of angle- closure disease in Asians1 and the involvement of iris in angle- closure diseases.2-6 In view of the lack of an iris grading system tailored for Asian eyes, we developed an iris grading ... to assess iris surface features from slit lamp photographs of Asian eyes Using this grading system, we found that eyes with more iris crypts had thinner iris and wider angle; irises with more ... between iris surface features and angle width in Asian eyes (submitted for publication) x INTRODUCTION 1.1 Specific Aims and Hypothesis Primary angle closure glaucoma (PACG) is a blinding condition...

báo cáo hóa học: "Co-activation: its association with weakness and specific neurological pathology" pptx

... Journal of NeuroEngineering and Rehabilitation 2006, 3:26 Authors' contributions RVD and CMW conceived of the study, and participated in its design and coordination and helped to draft the manuscript ... inclusion criteria for the subjects with neurological deficits ('neurology patients') were that the individual: a) had a condition causing lower limb weakness or perceived weakness (usually bilaterally) ... their clinical assessment and b) able to stand and walk for a short distance either independently or with crutches or another type of walking aid The categories of neurological deficit (see Table...

Xem thêm

Từ khóa: indomethacin induced enteropathy and its prevention with the probiotic bioflora in rats geriatric assessment and its interaction with nutrition controls and its relationship with autoantibody production presence and its connection with psychological safety 59 for disposal and derecognition generally with a debit to accounts in subgroup 57 and in the event of amounts not paid in to account 549 upon accrual for the full amount of both implicit and explicit interest with a debit to accounts in subgroup 24 25 53 or 54 and where applicable to account 473 hplc method for determination of purine bases adenine and guanine 2 with some modifications as described in 31 how do the pediatric musculoskeletal system and its response to stress differ from those in the adult folder and abstract its location with a dfs namespace a firm must conduct its business with due skill care and diligence perceptions folk taxonomies and the relationship with alternative medicine practices among hong kong people integration and management with enterprise manager 12c cloud control literature review trends in social media us in marketing with young customers and its effectiveness ck2α knockdown reversed nuclear translocation of β catenin and altered the expression of e cadherin and vimentin in association with repression of the transcription factors snail1 and smad2 3 expression —dna and gene structure and its distribution among tissues Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ