MODELING OF THE ELECTROCHEMICAL CONVERSION OF CO2 IN MICROFLUIDIC REACTORS
MODELING OF THE ELECTROCHEMICAL CONVERSION OF CO2 IN MICROFLUIDIC REACTORS
... on developing a mathematical modeling framework for the electrochemical conversion of CO2 to CO in microfluidic reactors Conversion of CO2 into CO is attractive due to the versatility of CO (with ... reduction of CO2 in a microfluidic cell In order to develop a mathematical model for the electrochemical reduction of CO2 in a microfluidic cell, a review of the available models for other types of reactors ... electrochemical reduction of CO2 in other CO2 electrolyzers and the models of MFCs, in the study of the electrochemical reduction of CO2 22 in a microfluidic reactor, physical modeling which presents...
- 132
- 2,495
- 0
Modeling of diffusion in mechanical alloying
... MODELING OF DIFFUSION IN MECHANICAL ALLOYING YANG CHENG, M ENG A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING DEPARTMENT OF MECHANICAL ENGINEERING NATIONAL UNIVERSITY OF SINGAPORE ... contribute little to the increase in homogenization kinetics in such diffusion process However, the density of defect during mechanical alloying increases with mechanical alloying duration and therefore ... influence diffusion in MA: (a) Decrease in crystalline size increases the diffusion area, and changes the diffusion mechanism from volume diffusion to grain boundary diffusion; (b) Increase in...
- 100
- 317
- 0
Tài liệu Báo cáo Y học: BIGH3 (TGFBI) Arg124 mutations influence the amyloid conversion of related peptides in vitro Implications in the BIGH3-linked corneal dystrophies pptx
... suggesting the importance of the hydrophobic NH2-end of the peptides In the same way, removing the CONH2-terminus of the peptides resulted in increased amyloid fibril formation This increase may be ... structures of the peptides, thereby limiting amyloid fibril formation Fig Secondary structure determination of the peptides by FT-IR spectroscopy in D2O Spectrograms of solutions containing the same peptides ... effective dialysis-based in vitro system to study the formation of amyloid fibrils from TGFBI protein -related synthetic peptides [14] Based on this system, we have now assessed the in uence of the structure...
- 8
- 469
- 0
Báo cáo khoa học: Modeling of ATP–ADP steady-state exchange rate mediated by the adenine nucleotide translocase in isolated mitochondria potx
... protons into the matrix, bypassing F0 F1-ATPsynthase [6] The dotted line shows the result of the modeling after estimation of the unknown parameters The con- Modeling of ANT ditions of the described ... novel kinetic assay of mitochondrial ATPADP exchange rate mediated by the ANT Biophys J 96, 24902504 Metelkin E, Goryanin I & Demin O (2006) Mathematical modeling of mitochondrial adenine nucleotide ... in the same concentration range as in (A) Inset: a representative experiment showing the effect of the addition of cATR (in the concentrations indicated in the inset gure, in nM) on DWm, as indicated...
- 14
- 444
- 0
modeling of the conduction in a wo3 thin film as ozone sensor
... spread out between adjacent grains is increased by oxidizing vapours and decreased in the opposite case [6–8], that implies a variation of resistivity in the same way Since 1980, many authors have ... polycrystalline layer made up of grains which have a great disparity of shape and size In this work, the grains are supposed to be quasi-spherical, identical in size, and single-crystal They are jointed, ... was already described The interaction between the gas and the surface was modeled by Langmuir isotherm and the electrical resistivity was evaluated by solving the transport equations This paper...
- 8
- 662
- 0
Báo cáo khoa học: Cytochrome P460 of Nitrosomonas europaea Formation of the heme-lysine cross-link in a heterologous host and mutagenic conversion to a non-cross-linked cytochrome c ¢ pot
... oligonucleotides were 5¢- GTAACTGTAAGAGAACTGGTCAC- 3¢ (Lys70 to Arg), 5¢- GTAACTGTAGCAGAACTGGTCA G- 3¢ (Lys70 to Ala), and 5¢- GGTAACTGTATATGAA CTGGTCAG- 3¢ (Lys70 to Tyr) The resulting plasmids, pUCYPKR, ... spectrum Although catalytic activity was lost in the mutants, the ligand-binding capability and thus the pentacoordinate nature of the heme was conserved Significantly, typical c -cytochrome a and ... Arciero as described earlier [22] for use as an electron acceptor in assays of hydroxylamine and hydrazine oxidation by cytochrome P460 In these assays, the absorbance of lM cytochrome c5 52 in...
- 7
- 384
- 1
Báo cáo hóa học: " Research Article Modeling On-Body DTN Packet Routing Delay in the Presence of Postural Disconnections" ppt
... computing packet transfer delay for a series of DTN routing algorithms that can be implemented in an on-body setting Although a number of papers in the literature [12–17] have studied DTN routing in ... implemented using a timer The delay of utility-based routing is expected to be lower than that in OPPT and RAND routing Also, the number of packet forwarding in utility-based routing is expected ... for on-body DTN networks The key objective of this work is to model the delivery delay of a number of representative DTN routing protocols, as identified above, in WBAN settings In [18, 19] the delay...
- 19
- 351
- 0
Báo cáo khoa học: " Kinetic modeling of tumor growth and dissemination in the craniospinal axis: implications for craniospinal irradiation" pps
... the ultimate goal of evaluating and optimizing therapeutic intervention within the contexts of these models [11] In this report we describe a kinetic model of tumor transport in the craniospinal ... of the spine temporarily while treatment of the brain continues Since the brain and spine are in communication via the cerebrospinal fluid, holding treatment in one compartment may threaten tumor ... levels of N-cadherin were seen in astrocytic tumors that had disseminated via the CSF [28] The values of kshed and kadh may in part be functions of the status of proteins such as the cadherins in tumors...
- 9
- 332
- 0
Báo cáo y học: "Predictive network modeling of the highresolution dynamic plant transcriptome in response to nitrate" pps
... from to 20 minutes, and modeled the resulting sequence using a dynamical model Instead of learning the dynamics directly from the gene expression sequence, we took into account uncertainty and ... regulatory network (GRN) (22 links) We used this network (next section) to analyze the NO3- response of sentinel genes to transcription factors We are confident in dynamical modeling, and in our ... regulatory network influences The identification of regulatory networks is a major aim of systems biology Relatively few studies have determined regulatory networks precisely enough so that the...
- 19
- 439
- 0
Báo cáo y học: " In silico modeling indicates the development of HIV-1 resistance to multiple shRNA gene therapy differs to standard antiretroviral therapy" docx
... the gene therapy ex vivo and returned to the patient to engraft and to continuously give rise to a supply of gene- containing CD4+ progeny T cells through the thymus [21] A proportion of all infected ... effects of HIV Methods This stochastic model of gene therapy for HIV incorporated the introduction of multiple anti-HIV shRNA into HSC cells which then differentiated into gene- containing progeny CD4+ ... harbouring a reduction in fitness will not survive in the presence of an adequate gene therapy The dynamics of virus outgrowth will be determined by i) efficacy of the gene therapeutic inhibiting...
- 14
- 255
- 0
Báo cáo y học: "Mathematical modeling of the socalled Allis test: a field study in orthopedic confusion" docx
... we are not aware of any investigations of the Allis protocol for determining aLLI In our search for information on the Allis test, nomenclatural and procedural issues became apparent, as explained ... reliable and valid ways of measuring LLI are needed There is no way to assess the clinical impact of LLI, both anatomical and functional, without having a convincing method of demonstrating it ... the distal legs – in either a supine or prone patient, usually by careful observation of the location of the feet Asymmetry in distal foot positions resulting from an actual discrepancy in the length...
- 7
- 709
- 0
Báo cáo y học: " Research In silico modeling of the specific inhibitory potential of thiophene-2,3-dihydro-1,5-benzothiazepine against BChE in the formation of β-amyloid plaques associated with Alzheimer''''s disease" doc
... al., In silico modeling of the specific inhibitory potential of thiophene-2,3-dihydro-1,5-benzothiazepine against BChE in the formation of ?-amyloid plaques associated with Alzheimer's disease Theoretical ... whereas the activity of AChE declines BChE may, therefore, play a more prominent role in ACh hydrolysis in the aging brain The presence of BChE in the amyloid plaques and neurofibrillary tangles of ... Compound A in the active sites of ChEs The docking of Compound A with both ChEs has provided valuable information about the nature of the binding interactions of benzothiazepine with these enzymes...
- 26
- 279
- 0
Mathematical modeling of transport phenomena in electrochemical energy storage systems
... declare that the thesis is my original work and it has been written by me in its entirety I have duly acknowledged all the sources of information which have been used in the thesis This thesis has ... information which have been used in the thesis This thesis has also not been submitted for any degree in any university previously _ Karthik Somasundaram 17 October 2012 à ...
- 172
- 347
- 0
Từ khóa: partial pressure of co2 in liquidup top down modeling of prices in deregulated wholesale power marketsmodeling of fixed bed catalytic reactorsmathematical modeling of catalytic fixed bed reactorswhat is the energy conversion that occurs in photosynthesismodeling of physicochemical and chemical processes in the interactions of fast charged particles with matterNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP