0
  1. Trang chủ >
  2. Ngoại Ngữ >
  3. Tổng hợp >

A Novel Combination of Negative and Positive Selection in Artificial Immune Systems

A Novel Combination of Negative and Positive Selection in Artificial Immune Systems

A Novel Combination of Negative and Positive Selection in Artificial Immune Systems

... detector candidates are generated by some random processes and matched against the given self sample set S The candidates that not match any element in S are eliminated and the rest are kept and stored ... (outlier, anomaly, etc) If incoming data instance matches any detector, it is claimed as non-self or anomaly Begin Begin Generate Random Candidates Input new samples Yes Match self samples? Match any ... state -of- the-art single NSAs proposed in [4] on some combinations of S , and r The training data set of selves S contains randomly generated binary strings The memory reduction is measured as...
  • 10
  • 353
  • 0
Báo cáo y học:

Báo cáo y học: "A novel combination of Chinese medicines to treat advanced cancers and lymphomas in rats" ppt

... Metabolism and kinetics of trichloroethylene in relation to toxicity and carcinogenicity Relevance of the mercapturic acid and pathway Chem Res Tocicol 1995, 8(1):3-21 Nomiyama K, Nomiyama H, Arai ... study confirms the findings of Goel et al and Khan et al that TCE significantly increased urea and creatinine in rats [30,31] and that TCE also increased the activity of LDH as reported by Lash ... 297(1):155-164 Lash LH, Tokarz JJ, Woods EB: Renal cell type specificity of cephalosporin- induced cytotoxicity in suspensions of isolated proximal tubular and distal tubular cells Toxicology 1994, 94:97-118...
  • 6
  • 336
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " First-line chemoimmunotherapy in metastatic breast carcinoma: combination of paclitaxel and IMP321 (LAG-3Ig) enhances immune responses and antitumor activity" pptx

... al.: First-line chemoimmunotherapy in metastatic breast carcinoma: combination of paclitaxel and IMP321 (LAG-3Ig) enhances immune responses and antitumor activity Journal of Translational Medicine ... dose of IMP321 s.c every two weeks for a total of 24 weeks (12 injections in total) The repeated single doses were administered on D2 and D16 of each 28-day cycle of paclitaxel (80 mg/m of paclitaxel ... reinforced at D170 This gradual but sustained activation was observed in a circulating APC population expanded both in terms of absolute numbers per μl of blood and in terms of percentages of...
  • 11
  • 472
  • 0
Báo cáo toán học:

Báo cáo toán học: " Could petroleum biodegradation be a joint achievement of aerobic and anaerobic microrganisms in deep sea reservoirs?" pptx

... 2008) Aerobic consortia was set up in Erlenmeyer flasks incubated in a shaker with temperature and agitation control (30 ºC and 150 rpm) during 60 days Laboratory anaerobic and mixed (aerobic/ anaerobic) ... Could petroleum biodegradation be a joint achievement of aerobic and anaerobic microrganisms in deep sea reservoirs? Georgiana F da Cruz1,#, Suzan P de Vasconcellos2, Célio F F Angolini1, ... that petroleum biodegradation is more likely to be a joint achievement of both aerobic and anaerobic bacterial consortium, refining our previous observations of aerobic degradation The aerobic...
  • 32
  • 450
  • 0
Báo cáo y học:

Báo cáo y học: "A knowledge synthesis of patient and public involvement in clinical practice guidelines: study protocol" doc

... framework: Patients and public involvement programs in clinical practice guidelines development and implementaFigure tion Conceptual framework: Patients and public involvement programs in clinical practice ... underpinnings of this knowledge synthesis We conceptualize a patient and public involvement program as an intervention that influences CPGs development and, indirectly, its implementation in clinical ... could play in CPGs development and implementation is increasingly attracting the attention of policymakers, health professionals, patients, and the public The grey zone of decision making Clinical...
  • 8
  • 395
  • 0
báo cáo khoa học:

báo cáo khoa học: " A knowledge synthesis of patient and public involvement in clinical practice guidelines: study protocol" ppsx

... The main decision-makers and stakeholders of this knowledge synthesis are patients, public, government, and health professional organizations in Canada and abroad that are interested in, or affected ... Medical Association, in its 2007 handbook on clinical practice guidelines, notes that patient and public involvement is 'increasingly common (and desirable) to gain input from non-health professionals ... these initiatives, major organizations in Canada have started to call for a CPGs development process that will engage patients and the public in a more meaningful and effective way The Canadian...
  • 8
  • 420
  • 0
A numerical study of heat and mass transfer in porous fluid coupled domains

A numerical study of heat and mass transfer in porous fluid coupled domains

... Ochoa-Tapia and Whitaker’s stress jump conditions for the flow, heat and mass transfer in porous/ fluid coupled domains, and to investigate their effects on local and global heat and mass transfer; ... incorporated with heat or mass transfer There are also limited numerical experiments and systematic results for heat and mass transfer in porous/ fluid coupled domains for certain numerical applications ... Interface Conditions For heat transfer interface conditions, usually continuities of temperature and heat flux are required (Neale and Nader, 1974; Vafai and Thiyagaraja, 1987; OchoaTapia and Whitaker,...
  • 286
  • 532
  • 0
a contrastive analysis of lexical and grammatical cohesion in inaugural speeches by the u s president barrack obama and vietnamese former president

a contrastive analysis of lexical and grammatical cohesion in inaugural speeches by the u s president barrack obama and vietnamese former president

... this thesis does not have a chance to discuss further Some of the following studies may be suggested for further studies:  A critical discourse analysis of U. S President Obama s inaugural speech ... investigation into how grammatical and lexical cohesive devices are used in US president Barrack Obama s and Vietnamese former president Nguyen Minh Triet s inaugural speeches was conducted and the ... 11 what it substitutes Substitution is classified into three types: nominal, verbal and clausal substitution - Nominal substitution: functions as Head of a nominal group and can substitute only...
  • 43
  • 1,028
  • 1
Life cycle assessment of carbon and energy balances in jatropha production systems of burkina faso

Life cycle assessment of carbon and energy balances in jatropha production systems of burkina faso

... Samplesites and distribution of Jatropha curcaslandͲuse systems in Burkina Faso. N:Number of sitesvisited.  20 Jatropha in Burkina Faso OnthePlateauCentral in theprovinceGanzourgou,investigationstookplace ... environmental sustainability of J. curcas biofuel production systems in Burkina Faso. Tothisend,the carbon and energy saving potential of existing J. curcas production systems is analyzed ... Mangoyana2008,Elbehrietal.2013).Further,theassociation of J.curcaswith carbon neutral biofuel and climate change mitigation remains to be justified for the production systems in Burkina Faso in view of agroͲinputs in energy ...
  • 183
  • 564
  • 0
TARGETING ACUTE PHOSPHATASE PTEN INHIBITION AND INVESTIGATION OF A NOVEL COMBINATION TREATMENT WITH SCHWANN CELL TRANSPLANTATION TO PROMOTE SPINAL CORD INJURY REPAIR IN RATS

TARGETING ACUTE PHOSPHATASE PTEN INHIBITION AND INVESTIGATION OF A NOVEL COMBINATION TREATMENT WITH SCHWANN CELL TRANSPLANTATION TO PROMOTE SPINAL CORD INJURY REPAIR IN RATS

... remembered and appreciated iii ABSTRACT Chandler L Walker TARGETING ACUTE PHOSPHATASE PTEN INHIBITION AND INVESTIGATION OF A NOVEL COMBINATION TREATMENT WITH SCHWANN CELL TRANSPLANTATION TO PROMOTE SPINAL ... downstream Akt and mTOR signaling promotes programmed cell death i.e apoptosis and autophagy PI3K = Phosphatidylinositol 3-Kinase; PTEN = Phosphatase and Tensin Homolog; mTOR = mammalian Target of Rapamycin; ... few treatments are currently available Investigating cell- specific responses, including signal pathways and associated proteins, is important for understanding spinal cord and brain pathology and...
  • 181
  • 235
  • 0
Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt

Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt

... second set, A5 2 (5¢AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8 (5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); third set, A5 3 (5¢-CGAGAGGAGCATTAGA-TAGATG Ó FEBS 2002 CAG-3¢)/TRHR-9 (5¢-GCCGAAATGTTGATGCCCA GATAC-3¢) (Fig ... CGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TC TGTTAAATGTACCTAAGTAGGCA-3¢) and TRHR2-2 sense (5¢-CAGCAAAATGGAAAATAGTAGC-3¢)/ TRHR2-4 antisense (5¢-CGACACTGTAGTAG-AGAT CACC-3¢), respectively The PCR ... 31 Itadani, H., Nakamura, T., Itoh, J., Iwaasa, H., Kanatani, A. , Borkowski, J., Ihara, M & Ohta, M (1998) Cloning and characterization of a new subtype of thyrotropin-releasing hormone receptors...
  • 11
  • 506
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Serial Combination of Rules and Statistics: A Case Study in Czech Tagging" potx

... TELRI J P Chanod and P Tapanainen 1995 Tagging French - comparing a statistical and a constraint-based method In Proceeedings of EACL-95, Dublin, pages 149–157 ACL Walter Daelemans, Jakub Zavrel, ... Alegria, J M Ariola, R Urizar, and I Aduriz 1998 Combining stochastic and rulebased methods for disambiguation in agglutinative languages In Proceedings of ACL/COLING’98, Montreal, Canada, pages ... Prague Jan Hajiˇ 2000 Morphological tagging: Data vs dicc tionaries In Proceedings of the NAACL’00, Seattle, WA, pages 94–101 ACL Jan Hajiˇ and Barbora Hladk´ 1997 Tagging of inc a flective languages:...
  • 8
  • 518
  • 0
Báo cáo khoa học: A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases docx

Báo cáo khoa học: A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases docx

... GCGAAGCTTACCAGACCGTGGACTAACGA CCCACCGTCTTCGAGAACTA CTTCCTTGGTCTTGGCAGAG CCAGACTAGATGTAGTATTTTTTG ATTAGAGCCAGATGCTTAAGTCC ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA and then treated with TGFb1; alternatively ... regulators of the activity of the RhoB promoter Smad2 and Smad3 proteins activate RhoA and RhoB GTPases and induce actin polymerization and microfilament reorganization in Swiss 3T3 fibroblasts To examine ... small GTPases RhoA and RhoB, and that this activation is essential for Rho GTPases Smad proteins in TGFb-induced actin reorganization TGFb-induced actin cytoskeleton reorganization in fibroblasts...
  • 14
  • 420
  • 0
A contrastive analysis of negative questions in English and Vietnamese

A contrastive analysis of negative questions in English and Vietnamese

... focus and contrastive – focus The next chapter is a contrastive analysis of the English and Vietnamese negative questions 10 CHAPTER 2: A CONTRASTIVE ANALYSIS OF ENGLISH AND VIETNAMESE NEGATIVE QUESTIONS ... deals with Negative question in English and Vietnamese a contrastive analysis In details, my Graduation Paper aims at: a Examining how the structures of English and Vietnamese negative questions ... questions and a contrastive analysis of negative questions in English and Vietnamese equipvalents Especially, the structures of English negative questions (negative Yes/No questions, negative Tag -questions, ...
  • 53
  • 1,586
  • 6

Xem thêm

Từ khóa: targeting delivery of a synergistic combination of doxorubicin and cisplatin with polymer drug complex micellar systemsa diminished quality of life and an increase in healthcare costsa cultural perspective of teaching and learning ete in a digitally connected worlddeveloping an in vitro model of glutamate injury that causes a mixed population of injured and dead neurons in preparations of hippocampal neurons in culturenishu harpreet singh 2002 the quality of primary education a case study of madurai and villupuram districts in tamil nadu india harvard graduate school of educationa brief history of public and private involvement in schools in the netherlandsa brief history of public and private involvement in schools in chilea brief history of public and private involvement in schools in irelandthe standard chemotherapy for epithelial ovarian cancer eoc patients is currently a combination of taxane and platinum howevera 13 combination of inline sensors with electronic and fluidic bus systemwhen the carrying amount of assets and liabilities recognised in a business combination differs from their tax basea combination of symmetric and asymmetric encryptionthe isolation characterization and development of a novel class of potent antimitotic macrocyclic depsipeptides the cryptophycinspbc aih overlap conditions to a combination of udca and immunosuppressantsdetermination of cell speci fi c receptor binding using a combination of immunohistochemistry and in vitro autoradiography relevance to therapeutic receptor targeting in cancerNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ