developing an in vitro model of glutamate injury that causes a mixed population of injured and dead neurons in preparations of hippocampal neurons in culture
Báo cáo y học: "Propofol: neuroprotection in an in vitro model of traumatic brain injury" pot
... fluorescence imaging Microscopy and staining PI is a nucleic acid intercalating agent that is membrane-impermeable in vital cells with intact cell membranes In damaged cells gaps in the cell membrane allow ... the nature of the model it excludes mechanisms of injury that may influence brain damage in the in vivo situation such as the absence of any injury pathways related or due to brain swelling inside ... Gaudio AR, Pellegrini-Giampietro DE: Erythropoietin attenuates post-traumatic injury in organotypic hippocampal slices J Neurotrauma 2004, 21:1103-1112 Adembri C, Massagrande A, Tani A, Miranda M,...
- 8
- 329
- 0
Báo cáo y học: "Gender differences and inflammation: an in vitro model of blood cells stimulation in prepubescent children" pptx
... conceived of the study, and participated in its design and coordination All authors read and approved the final manuscript Author Details 1Department of Pulmonology and Allergology, Université ... female advantage in the host response to injury and infection Shock 2007, 27(6):597-604 11 Brown Carolyn J, Carrel Laura, Willard Huntington F: Expression of Genes from the Human Active and Inactive ... Stimulations by LPS and PW mitogen of blood cells from male and female prepubescent children showed quantita- Page of tive and qualitative differences in the cytokine responses that could explain...
- 7
- 377
- 0
Báo cáo y học: "Gender differences and inflammation: an in vitro model of blood cells stimulation in prepubescent children" pot
... conceived of the study, and participated in its design and coordination All authors read and approved the final manuscript Author Details 1Department of Pulmonology and Allergology, Université ... female advantage in the host response to injury and infection Shock 2007, 27(6):597-604 11 Brown Carolyn J, Carrel Laura, Willard Huntington F: Expression of Genes from the Human Active and Inactive ... Stimulations by LPS and PW mitogen of blood cells from male and female prepubescent children showed quantita- Page of tive and qualitative differences in the cytokine responses that could explain...
- 7
- 336
- 0
Báo cáo y học: " Cysteinyl-leukotrienes in the regulation of β2-adrenoceptor function: an in vitro model of asthma" ppsx
... human bronchial rings Relaxant responses to salbutamol in carbachol-contracted human bronchial rings Values of 100 and on y-axis represent maximal force in response to 10-6M carbachol and minimal ... salbutamol-induced relaxation in challenged human bronchial rings Relaxant responses to salbutamol in five carbachol-contracted human bronchial rings Values of 100 and on y-axis represent maximal ... conceived and designed the study, coordination and manuscript preparation MB was involved in isolated human bronchial ring experiments and helped in manuscript preparation SC participated in the...
- 11
- 243
- 0
Báo cáo y học: " Effect of transverse gap-junction channels on transverse propagation in an enlarged PSpice model of cardiac muscle" pps
... C10 and D10, D1 and E1, E10 and F10, F1 and G1, G10 and H10, H1 and I1, I10 and J10 Assuming that each gj-channel has a conductance of 100 pS, these channels corresponded to a shunt resistance across ... in a zigzag pattern across the 10 × 10 model These were located between cells A1 0 and B10, B1 and C1, C10 and D10, D1 and E1, E10 and F10, F1 and G1, G10 and H10, H1 and I1, I10 and J10 In each ... MΩ (100 channels) and 10 MΩ (1000 channels) RBT is the bundle termination resistance at each end of the bundle, and has the standard value 1.0 KΩ The standard values for Rjc and Rjct are 25 MΩ...
- 11
- 211
- 0
developing an advanced windows phone 7.5 app that connects to the cloud
... The application uses standard controls throughout so that the appearance and behavior of the application matches the Windows Phone standard appearance and behavior The section, “Displaying Data,” ... model in MVVM is an implementation of the application’s domain model that can include a data model along with business and validation logic Often, the model will include a data access layer In ... details of the overall structure of the application, the way that the Model- View-ViewModel (MVVM) pattern is implemented, and the way that the application displays data and manages commands and...
- 208
- 352
- 0
An e-Health System for the Elderly (Butler Project): A Pilot Study on Acceptance and Satisfaction pot
... challenge is to create a clinical and health system that can accommodate a growing population of elderly, incorporating primary levels of intervention that can reduce costs and facilitate healthy ... session, using an adaptation of a visual analog scale consisting of seven facial expressions, from (maximum dissatisfaction face) to (maximum satisfaction face) Difficulty of use Participants assessed ... maintaining their interest and motivation, was very encouraging However, we will have to wait to discover what happens in the case of a clinical population who may be located in nursing homes and...
- 8
- 733
- 0
Báo cáo hoa học: " Research Article Solution and Stability of a Mixed Type Additive, Quadratic, and Cubic Functional Equation" pdf
... Korean Mathematical Society 32 M E Gordji, A Ebadian, and S Zolfaghari, “Stability of a functional equation deriving from cubic and quartic functions,” Abstract and Applied Analysis, vol 2008, Article ... linear transformation in Banach spaces,” Journal of the Mathematical Society of Japan, vol 2, pp 64–66, 1950 Th M Rassias, “On the stability of the linear mapping in Banach spaces,” Proceedings ... 801904, 17 pages, 2008 33 M E Gordji and H Khodaei, “Solution and stability of generalized mixed type cubic, quadratic and additive functional equation in quasi-Banach spaces,” Nonlinear Analysis:...
- 17
- 358
- 0
Báo cáo y học: "CD47 associates with alpha 5 integrin and regulates responses of human articular chondrocytes to mechanical stimulation in an in vitro model" pdf
... 5'-CACAAGTGTATTCCTTTCACGTCTTACTACTC-3'; glyceraldehyde-3phosphate dehydrogenase (GAPDH), 5'-CCACCCATGGCAAATTCCATGGCA-3' and 5'-TCTAGACGGCAGGTCAGGTCCACC-3'; and aggrecan, 5'TGAGGAGGGCTGGAACAAGTACC-3' and ... function-blocking anti-CD47/IAP antibody B6H12 is an anti-CD47/IAP antibody that has partial agonist activity SE 5A5 is an anti-SIRPα antibody N = ap < 0.001; bnot significant IAP, integrin-associated ... conceived of the study, participated in its design and coordination, participated in the interpretation of results, and predominantly drafted the manuscript All authors read and approved the final manuscript...
- 11
- 441
- 0
Báo cáo y học: " Pharmacological inhibition of leukotrienes in an animal model of bleomycin-induced acute lung injury" doc
... the intratracheal instillation of bleomycin in mice Methods Animals Male CD mice (25–35 g; Harlan Nossan; Italy) were housed in a controlled environment and provided with standard rodent chow and ... drugs in any of the parameters investigated This might suggest on a first basis that leukotriene B4 have not a predominant role in mediating inflammation and fibrosis at least in bleomycin treated ... Goossens J: Effects of antioxidants on cyclooxygenase and lipoxygenase activities in intact human platelets: comparison with indomethacin and ETYA Prostaglandins 1983, 26:725-730 Ziboh VA, Yun M, Hyde...
- 12
- 265
- 0
Báo cáo y học: "A mechanism of airway injury in an epithelial model of mucociliary clearance" doc
... magnification of 400× (panels A and B respectively) and Scanning electron micrographs of control and MB-treated palates at a magnification of 400× (panels A and B respectively) and at 3500× (panels ... have been shown to play a role in airway injury and remodeling [7,8] and in cellsignaling pathways [14] Materials and Methods Development of a frog palate injury model A fresh frog palate was ... The important findings of this study are: the development of a model of airway epithelial injury that can be used for study of ultra-structural and molecular events in airway injury that are directly...
- 9
- 301
- 0
Báo cáo y học: " Intravenous glutamine decreases lung and distal organ injury in an experimental model of abdominal sepsis" ppsx
... histological changes, attenuating epithelial cell apoptosis of the lung and distal organs In addition, Gln acted on balancing pro- and antiinflammatory cytokines, decreasing CINC-1 and IL-6 in BALF and ... heparin (1000 IU) was intravenously injected in the vena cava The trachea was clamped at cmH2O PEEP, and the abdominal aorta and vena cava were sectioned, yielding a massive haemorrhage that ... epithelial cell apoptosis in kidney, liver, and small intestine villi Additionally, the balance of pro- and anti-inflammatory cytokines in bronchoalveolar lavage fluids (BALF) and peritoneal lavage...
- 11
- 397
- 0
Báo cáo y học: "Characterization of Human Erythrocytes as Potential Carrier for Pravastatin: An In Vitro Study"
... Percent of pravastatin and hemoglobin release from loaded erythrocytes in PBS and plasma Data were tested by one-way analysis of variance and represented as mean ± SD Three samples in each group ... Castaneda AZ, Marinero ML, Lanao JM In vitro studies of amikacin-loaded human carrier erythrocytes Transl Res 2008; 152(2):59-66 25 Hamidi M, Zarei N, Zarrin AH, Mohammadi-Samani S Preparation and in ... 281 Oda S, Nagahama R, Nakano K, Matoba T, Kubo M, Sunagawa K, Tominaga R, Egashira K Nanoparticle-mediated endothelial cell-selective delivery of pitavastatin induces functional collateral arteries...
- 9
- 829
- 0
Báo cáo khoa học: "Proximity in Context: an empirically grounded computational model of proximity for processing topological spatial expressions∗" docx
... values displayed in Figure are normalised so that proximity values have a mean of and a standard deviation of This normalisation simply means that all values fall in the same region of the scale, ... scale, and can be easily compared visually 750 and Roy (2002) use machine learning to obtain a statistical mapping between visual and linguistic features Gorniak and Roy (2004) use manually constructed ... P and a landmark L is a function of both the distance between the point and the location of the landmark, and the salience of the landmark To represent distance we use a normalised distance function...
- 8
- 258
- 0
SUPERVISORY, INSTRUCTIONAL SKILLS AND PROFESSIONAL PERFORMANCE OF TEACHERS IN VOCATIONAL COLLEGES IN NGHE AN PROVINCE: BASIS FOR DEVELOPING AN ENHANCEMENT PROGRAM
... Practice Teachers are able to make learning engaging and valued They are able to create and maintain safe, inclusive and challenging learning environments and implement fair and equitable behaviour ... changing circumstances; and - The teacher values planning as a collegial activity Performances - As an individual and a member of a team, the teacher selects and creates learning experiences that ... 'understanding and presenting diverse perspectives to encourage critical thinking Standard No 5: The teacher uses an understanding of individual and group motivation and behavior to create a learning...
- 117
- 375
- 0
Báo cáo sinh học: " Development of an in vitro cleavage assay system to examine vaccinia virus I7L cysteine proteinase activity" pptx
... residue mutated to an alanine (pI7LH24 1A) The extracts are prepared as described in the Materials and Methods The extracts are mixed and incubated with the substrates for hrs and then analyzed through ... protease, and an ubiquitin-degrading enzyme in yeast, as well as the identity of a catalytic triad composed of histidine, cysteine, and aspartic acid, I7L has been classified as a cysteine proteinase ... A1 0L (P 4a) gene was amplified by polymerase chain reaction using oligonucleotides KH10 (5' CATGCCATGGATGATGCCTATTAAGTCAATAGTTACT CTT-3') and KH11 (5'-CCGCTCGAGTTATTCATCATCAAAAGAGACAGAGTC-3'), digested...
- 8
- 481
- 0
Báo cáo hóa học: " Leg joint power output during progressive resistance FES-LCE cycling in SCI subjects: developing an index of fatigue" doc
... Hull and Jorge's model for biomechanical analysis of bicycle pedaling [10] Moments of inertia and centers of gravity were calculated using Winter's anthropometrical table [28] Instantaneous joint ... 5.13 A one-way analysis of variance (ANOVA) was performed in order to evaluate the difference in mean cadence, mean stimulation intensity, mean joint power outputs, total power output and mean ... (HPO) and resultant pedal force (RPF) (Table 1) Stimulation intensity was expressed as a percentage of maximum intensity, 140 mA Mean APO and KPO decreased with increasing resistance Mean stimulation...
- 12
- 373
- 0
báo cáo hóa học: " Tumor necrosis factor-mediated inhibition of interleukin-18 in the brain: a clinical and experimental study in head-injured patients and in a murine model of closed head injury." pot
... Dinarello CA, Novick D, Rubinstein M, Otto VI, Rancan M, Kossmann T, Redaelli CA, Trentz O, Shohami E, Stahel PF: Elevated intracranial IL-18 in humans and mice after traumatic brain injury and ... conception and planning of the experiments, as well as for performing the animal experiments, collection of the human cerebrospinal fluid samples and cytokine measurements in human and murine tissue samples, ... weights of 25 to 32 g The animal experiments were performed in compliance with the guidelines of the Federation of European Laboratory Animal Science Association (FELASA) and approval was granted...
- 6
- 436
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25