A Horn Fragment with PTime Data Complexity of Regular Description Logic with Inverse
A Horn Fragment with PTime Data Complexity of Regular Description Logic with Inverse
... operators [A] and A , where A is a finite automaton over alphabet R We call [A] (resp A ) a universal (resp existential) automaton-modal operator Automaton-modal operators were used earlier, among ... assertions of the form A( a) or r (a, b) A knowledge base R, T , A is called a Horn- RegI knowledge base if T is a Horn- RegI TBox and A is a Horn- RegI ABox When T is a clausal Horn- RegI TBox and A is a reduced ... Nguyen, A Szałas, ExpTime tableau decision procedures for regular grammar logics with converse, Studia Logica 98 (3) (2011) 387–428 [22] L Nguyen, A Szałas, On the Horn fragments of serial regular...
- 15
- 257
- 0
báo cáo hóa học:" The net cost of incorporating resistance testing into HIV/AIDS treatment in South Africa: a Markov model with primary data" pot
... the three main cost inputs to the model: the cost of a year of first-line treatment; the cost of a year of second-line treatment; and the cost of a resistance assay For the treatment costs, we ... duration on treatment was very small Table indicates the cost and other input parameters used in the analysis Second-line therapy costs nearly two-and -a- half times that of first-line therapy, as ... than the cost of the other scenarios Using the baseline cost values, the total costs of all three scenarios are almost the same The sensitivity analysis illustrated in Figure shows that the baseline...
- 6
- 386
- 0
Báo cáo y học: "The emerging modern face of mood disorders: a didactic editorial with a detailed presentation of data and definitions" potx
... Fountoulakis, The emerging modern face of mood disorders: a didactic editorial with a detailed presentation of data and definitions Annals of General Psychiatry 2010, 9:14 Page 22 of 22 ... especially true during the teenage and early adult years, relates mainly to cyclothymia and probably represents attempts at self-medication for the mood liability During the withdrawal period many ... efficacy of interpersonal psychotherapy Non-standardised psychotherapies, such as psychodynamic psychotherapy and reminiscence therapy, are also proposed as appropriate treatments for geriatric...
- 22
- 421
- 0
Báo cáo y học: " Relationship of compartment-specific structural knee status at baseline with change in cartilage morphology: a prospective observational study using data from the osteoarthritis initiative" pps
... cartilage plates from a sagittal data set in a different person: The femoro-tibial cartilages are labeled with the same colors as in (c), the patellar cartilage is labeled magenta and the trochlear ... that may potentially result from small imaging artifacts Analysis of variance (ANOVA) was used first to test whether categorical features of structural knee status in fixed flexion radiographs ... sex, and BMI in the GLM Discussion This study investigates the relation of compartment-specific structural radiographic knee and MRI cartilage status at baseline with medial femorotibial cartilage...
- 10
- 483
- 0
Ant functional group succession dynamics correlates with the age of vegetation succession data analysis of worldwide studies and a case study of a secondary tropical rain forest in singapore
... FOREST OF SINGAPORE Introduction The main island of Singapore is located off the southern tip of the Malay Peninsula and most of the island consisted of tropical lowland rain forest for much of the ... demonstrated this pattern of functional group succession by conducting a study of the ant community within a secondary tropical rain forest in Singapore Using the mathematical models, the ages of ... New Caledonia Barro Colorado Island, Panama Barro Colorado Island, Panama Atherton Tablelands, Australia Kununurra, Australia Vicosa, Brazil Mkomazi Game Reserve, Tanzania Popondetta, Papua New...
- 109
- 536
- 0
Báo cáo y học: "The Diels-Alder-Reaction with inverse-Electron-Demand, a very efficient versatile Click-Reaction Concept for proper Ligation of variable molecular Partners"
... study reveals the kinetic pathway for an interfacial reaction Journal of the American Chemical Society 2004; 126: 15613-7 Pozsgay V, Vieira NE, Yergey A A method for bioconjugation of carbohydrates ... ring systems are commercially available or are easily to prepare By this means a wide range of dienophilic compounds is available for DARinv In order to obtain reaction times in the range of minutes ... hormone-refractory prostate cancer [37-39] Additionally this DARinv technology attracts increasing notice to further medical applications, especially in oncological diagnostics and therapy at the molecular...
- 10
- 623
- 0
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents
... adjectives with the definitions of adjectives and their semantic and syntactic functions of English adjectives Chapter III is a study to a new approach to semantic and syntactic functions of English adjectives ... Graduation paper Declaration Title: A new approach to semantic and syntactic functions of English adjectives A contrastive analysis with their Vietnamese equivalents (Graduation paper submitted ... paper, particularly adjectives in English The writer decided to study a new approach to semantic and syntactic functions of English adjective, apart from that making a contrastive analysis with their...
- 44
- 1,746
- 7
An experimental investigation of heat transfer and fluid flow in a rectangular duct with inclined discrete ribs
... rib arrangements on heat transfer and flow behavior in a rectangular rib roughened passage” International Journal of Heat and mass transfer; 123: 675-681, 2001 [6] Lau S.C., McMillin R.D and Han ... studies of augmented heat transfer and friction in asymmetrically heated rectangular ducts with ribs on the heated wall in transverse, inclined, V-continuous and V- discrete pattern Int Journal of Heat ... Tariq, A. , Keshav Kant and Panigrahi, P K., Heat transfer enhancement using an internally threaded tube”, Proceeding of the 4th ISHMT-ASME and 15th National Conference on Heat and Mass transfer...
- 12
- 831
- 0
Time and performance a three part study examining the relationships of job experience, organizational tenure, and age with job performance
... of Job Experience, Organizational Tenure, and Age with Job Performance Michael C Sturman Working Paper 01 – 05 Time and Performance CAHRS WP 01-05 TIME AND PERFORMANCE: A THREE- PART STUDY EXAMINING ... current jobs Analyses As this study examines a sample of employees over the span of their careers, and because the nature of this sample made organizational tenure and age nearly Page 25 Time and Performance ... with a mean age of 20 years), and becomes negative for samples with mean temporal variable levels of 14 years of organizational tenure and 41 years of age Discussion and Limitations The meta-analytic...
- 44
- 429
- 0
Structural and semantic features of english idioms referring to head and a contrastive analysis with vietnamese idioms
... occurrence of the word "Head" in English and Vietnamese language in general and in idioms in particular 15 Chapter structural and semantic features of English and Vietnamese idioms referring to head ... for learning and teaching English idioms The aim of the thesis in to make learners of English understand the semantic and structural features of English idioms referring to "Head" as well as their ... semantic features of English and Vietnamese idioms referring to Head The second aim is to help English learners improve their knowledge of English and Vietnamese idioms referring to Head and also...
- 54
- 1,793
- 13
Tài liệu Create a New Table with Data from Existing Tables doc
... build the data adapter ' and fill the data table Dim odaResults As _ New OleDb.OleDbDataAdapter("Select * From MyProdAndCat", BuildCnnStr("(local)", "Northwind")) odaResults.Fill(dtResults) Catch ... Figure 6.8 These results are based on a new table created by the SQL string that is displayed Comments You will probably want to go ahead and drop the new table after you are finished using it if ... odaResults.Fill(dtResults) Catch excp As Exception MessageBox.Show(excp.Message) Exit Sub End Try ' Assign the data table to the data grid's DataSource property Me.dgResults.DataSource = dtResults End Sub...
- 4
- 376
- 0
Tài liệu HOW INTERNET PROTOCOL-ENABLED SERVICES ARE CHANGING THE FACE OF COMMUNICATIONS: A LOOK AT VIDEO AND DATA SERVICES ppt
... Today’s hearing is entitled ‘ How Internet Protocol-Enabled Services Are Changing the Face of Communications: A Look at Video and Data Services. ’’ Video and data are the second and third legs of the ... HCOM1 HOW INTERNET PROTOCOL-ENABLED SERVICES ARE CHANGING THE FACE OF COMMUNICATIONS: A LOOK AT VIDEO AND DATA SERVICES WEDNESDAY, APRIL 20, 2005 HOUSE OF REPRESENTATIVES, COMMITTEE ON ENERGY AND ... ensure that the underlying signal area data is always accurate The benefits to the consumers and the broadcasters are many Local broadcasters will be able to bring their programming to the Internet, ...
- 99
- 514
- 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT ... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG...
- 14
- 517
- 0
Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt
... S-oxidation of thioanisole As the above results showed that the best system for the S-oxidation of thioanisole associated H2O2 as an oxidant with MP8 as a catalyst in the presence of tBuOH as an ... case, because an oxidative degradation of the catalyst occurred This was shown by a progressive disappearance, in its absorption spectrum, of the soret band at 396 nm that is characteristic of ... complex into a hydrophobic pocket with no change of the Fe(II) spin state and no replacement of any of the two axial ligands of the iron, His18 or RNO, by an amino acid side-chain of the antibody...
- 7
- 447
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ