The Omission of that
Metaphor, based on the association of similarity, is one of the two basic types of semantic transference that have been an interest for many linguistic researchers
... on the association of similarity, is one of the two basic types of semantic transference that have been an interest for many linguistic researchers. Galperin ( 1981: 139-40) states that the ... part the language is playing, what it is that the participants are expecting the language to do for them in that situation, the symbolic organisation of the text, the status that it has, and ... to their constituency relation: the highest-ranking units consist of units of the rank immediately below, these units consist of units at the next rank below, and so on, until we arrive at the...
- 53
- 1,013
- 3
Evaluation of the Characteristics of Microorganisms that Contribute to Denitrification in the Paddy Drainage Treatment Apparatus by Quinone Composition Measurement
... Accepted October 21, 2010. - 421 - Evaluation of the Characteristics of Microorganisms that Contribute to Denitrification in the Paddy Drainage Treatment Apparatus by Quinone Composition Measurement ... denitrification in paddies. The arrangement of environmental factors of paddy, focusing on the Q-8 and other highly-contained-quinones, will lead to the finding of paddy characters accomplishing high denitrification ... with the water treatment apparatus improvement. Furthermore, the types of quinone related to denitrification rates in the apparatus were thought to be similar to those in the surface of paddy...
- 7
- 570
- 0
Tài liệu Develop computer programs for simplifying sums that involve binomial coefficients: The Art of Computer Programming, Volume 1: Fundamental Algorithms pdf
... you that a better first step is to reach for your computer! [50] Develop computer programs for simplifying sums that involve binomial coefficients.Exercise 1.2.6.63 in The Art of Computer Programming, ... 1)(k − n − 1).3. For each of the four parts of Problem 2 above, write out the complete proof of the identity, using the full text of the standardized WZ proof together with the appropriate rational ... that computers had not yet been invented in Jacobi’s time. It is possible that they would have prevented the discovery of one of the most beautiful theoriesin the whole of mathematics: the theory...
- 222
- 550
- 0
Tài liệu THE CRAFT OF WRITING SCIENCE FICTION THAT SELLS pptx
... tamperwith the laws of nature to suit the needs of the story. The archetype of this requirement is Tom Godwin's " ;The Cold Equations,"in which the laws of nature are the background of the ... about science fiction writing, although the techniquesfor writing science fiction can be used for any kind of fiction writing. There are three main reasons for concentrating on science fiction, ... clear about that before I began to write the story. He THE CRAFT OF WRITING SCIENCE FICTION THAT SELLS BEN BOVAAuthor of Mars and MilleniumThis book is based on Notes to a Science Fiction Writer,...
- 141
- 522
- 0
Tài liệu Learn that economics is about the allocation of scarce pdf
... current chairman of the Federal Reserve?Who is the current chair of the Council of EconomicAdvisers? Who is the current secretary of the treasury?12. Look up one of the Web sites listed in Table ... that their opportunity cost of college is very high. It is not surprising that they often decide that the benefit is not worth the cost.PRINCIPLE #3: RATIONAL PEOPLE THINK AT THE MARGINDecisions ... objectivity. They approach the study of the economy in much the same way as a physicist approaches the study of matter and a biologist approaches the study of life: They devise theories,collect...
- 790
- 581
- 0
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc
... Journal compilation ê 2010 FEBS 1287 Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme Kerstin ... with substrate- freeAppA the C a atoms are 2.41 A ˚apart, whereas for the substrate- free PhyK and the substrate- loaded AppA the averaged distance is only 1.87 A ˚.Distinct conformational changes ... dephosphorylation of phytate [5].Although the amino acid sequence of E. coli glucose-1-phosphatase (G1P) is related to AppA, the crystal structure suggests that phytate can bind to the active site of...
- 13
- 766
- 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
... 1903 Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane Vincenzo Zara1, Laura Conte1and Bernard ... respiratory chain, the assistance of specificchaperone proteins is also required. The available dataindicate that the accessory factor Bcs1p is involved in the binding of ISP to an immature bc1intermediate[28,29] ... the structural rearrangement of the yeast bc1 complex that finally leads to the supercomplex formation. These newfindings open up several avenues of investigation andillustrate that a significant amount...
- 15
- 639
- 0
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc
... a wider variety of substratesthan do CBP21 and CHB1. Degradation of a- and b-chitin The degradation rates of a- and b-chitin were assayedwith LlChi1 8A in the presence or absence of LlCBP3 3A. ... 5Â-GGTATTGAGGGTCGCCATGGTTATGTTCAATCACCA-3Â; reverse primer, 5Â-AGAGGAGAGTTAGAGCCTTACAAGAAGGGTCCAAAGA-3Â). The PCRproduct was puried, treated with T4 exonuclease tocreate vector-compatible overhangs and annealed to a prepared ... the start, in the middle and at the end of each series of sam-ples. The resulting average values of the standards (display-ing standard deviations of < 5%) were used forcalibration. All measurements...
- 14
- 683
- 0
Economic Effects of Reducing the Fiscal Restraint That Is Scheduled to Occur in 2013 docx
... 254(i), no longer apply. ECONOMIC EFFECTS OF REDUCING THE FISCAL RESTRAINT THAT IS SCHEDULED TO OCCUR IN 2013 7CBOTable 3.Effect on Employment of Reducing Fiscal Restraint in 2013 Under Various ... by CBO. ECONOMIC EFFECTS OF REDUCING THE FISCAL RESTRAINT THAT IS SCHEDULED TO OCCUR IN 2013 5CBO 2013 and, therefore, partway through fiscal year 2013; as a result, fiscal year 2013 includes ... REDUCING THE FISCAL RESTRAINT THAT IS SCHEDULED TO OCCUR IN 2013 CBO Growing debt would increase the likelihood of a sud-den fiscal crisis, during which investors would lose confidence in the...
- 10
- 538
- 0
Authoring and Generating Health-Education Documents That Are Tailored to the Needs of the Individual Patient doc
... problems that arise when a tailored instance of the document is to be generated.1 The Value of Tailored Health-Education Documents Health-education and patient- information brochures and leaflets are ... a list of the patient conditions that the author is using to specify the selection of pieces of text. The right-hand portion of the screen contains a window on the text of the master document. ... three aspects of the project: the kinds of tailoring that are appropriate for health-education documents; the nature of a tailorablemaster document, and how it can be created; and the linguistic...
- 12
- 379
- 0
Báo cáo khoa học: Characterization of the interactions of the nephrin intracellular domain Evidence that the scaffolding protein IQGAP1 associates with nephrin potx
... obtainenough protein for MALDITOF-MS. Intracellular domain of nephrin X. L. Liu et al.234 FEBS Journal 272 (2005) 228243 ê 2004 FEBS Characterization of the interactions of the nephrin intracellular domain Evidence ... map the areas of the neph-rin intracellular domain responsible for IQGAP1 binding. All constructs containing the C-terminal half of the intracellular domain (amino acids 1167–1256)bound IQGAP1, ... They alsoindicate how important the elucidation of the protein protein interactions formed by nephrin are for the X. L. Liu et al. Intracellular domain of nephrin FEBS Journal 272 (2005) 228243...
- 16
- 333
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... antibodies L. Rian˜ o-Umbarila et al.2592 FEBS Journal 272 (2005) 25912601 ê 2005 FEBS A strategy for the generation of specific human antibodies by directed evolution and phage display An example ... CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCCJH3.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCCJH4-5.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCCJH6.link ... single-chain antibody fragments (scFvs) from a single human donor by individual amplification of all heavy and light variable domains (1.1 · 108recombinants). The lib-rary was panned using the phage display...
- 11
- 679
- 0
Từ khóa: micrornas mirnas are noncoding regulatory rnas that function via the degradation of target mrnas and inhibition of translation they are found widely in higher eukaryotic organismsthe synthesis of the modified tetrapyrrole known asd1haem requires several dedicated proteins which are coded for by a set of genes that are often found adjacent to the structural genewe identified and characterized cytosine dna mtase genes that are activated with the onset of reproductive development in riceresulting in dramatic increases in healthcare costs understanding the processes and metabolic perturbations that contribute to the expansion of adipose depots accompanying obesity is central to the development of appropriate therapeutic strategiesvarious disciplines that deal with the evolution of mansymbol that represents the cost of raising capitalNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ