finite element simulation and analysis of local stress concentration in polymers with a nonlinear viscoelastic constitutive model
Báo cáo y học: "Aplasia and Agenesis of the Frontal Sinus in Turkish Individuals: A Retrospective Study Using Dental Volumetric Tomograph"
... ex-tending above a line tangential to the supraorbital margin (horizontal line). Frontal sinus aplasia is also defined by an oval-shaped sinus with the lateral margin medial to a vertical line ... supercilliary arcs does not indicate the absence, presence or size of the frontal sinus [3]. The objective of this study was to investigate the prevalence of frontal sinus aplasia and agenesis using ... supraorbital margin. Frontal sinus aplasia was also defined by an oval-shaped sinus with the lateral margin medial to a vertical line drawn through the middle of the orbit (vertical line)...
- 5
- 577
- 0
Review and analysis of renewable energy perspectives in Serbia
... Agency of International Business and Cooperation, 2009. [17] Ministry of Energy and Mining. Renewable Energy in Serbia. Ministry of Energy and Mining, 2009. [18] Statistical Office of the ... Republic of Serbia. Strategy of development of energy industry of Republic of Serbia until 2015, draft report, 2005. [6] EPS – Electric Power Industry of Serbia, Ministry of Energy and Mining of ... senior energy expert in the fields of energy policy and modelling, development & administration of DSS and in lectures and seminars of the NTUA and theTechnical Chamber of Greece regarding energy...
- 14
- 674
- 0
Báo cáo khoa học: Functional dissection of Escherichia coli phosphotransacetylase structural domains and analysis of key compounds involved in activity regulation potx
... compilation ê 2010 FEBS Functional dissection of Escherichia coli phosphotransacetylase structural domains and analysis of key compounds involved in activity regulation Valeria Alina Campos-Bermudez, ... islocated in the C-terminal domain, the E. coli PtaN-terminal domain is involved in stabilization of thehexameric native structure, in expression of the max-imum catalytic activity, and in allosteric ... ResultsExpression and purification of E. coli Pta and truncated Ptas containing the C-terminal endBy analysis of the protein domain architecture of E. coli Pta, three conserved domains can be detected[Conserved...
- 10
- 507
- 0
báo cáo hóa học: " The Locomotor Capabilities Index; validity and reliability of the Swedish version in adults with lower limb amputation" ppt
... and advanced locomotor skills of the lower limb amputee with the pros-thesis and assesses level of independence" [13]. The LCIhas demonstrated good validity and reliability in adults with ... successfully fitted with a prosthesismay differ in how much they use the prosthesis and in the type of activities they can perform with their prosthesis[7].Walking ability with a prosthesis depends ... Locomotor Capabilities Index; validity and reliability of the Swedish version in adults with lower limb amputationBrita Larsson†1, Anton Johannesson*†2, Ingemar H Andersson3 and Isam Atroshi4,5Address:...
- 9
- 597
- 0
Báo cáo sinh học: " Analysis of machine perfusion benefits in kidney grafts: a preclinical study" doc
... MA, Shenton BK, Balupuri S, Gupta AJ, Asher J, Talbot D:Weight increase during machine perfusion may be an indicator of organand in particular, vascular damage. Ann Transplant 2004, 9:31-32.41. ... group.Functional parametersAnimals were placed in individual metabolic cages forblood and urine collection. Functional parameters weremeasured using an automatic analyzer (Modular auto-matic analyzer, ... was invaluable. Alanine aminopeptidase andb-N-acetylglucosaminidase are found in kidney tubularcell s br ush border and their presence in urine is a com-monly accepted sign of tubular damage...
- 13
- 483
- 0
báo cáo hóa học:" Analysis of machine perfusion benefits in kidney grafts: a preclinical study" pdf
... MA, Shenton BK, Balupuri S, Gupta AJ, Asher J, Talbot D:Weight increase during machine perfusion may be an indicator of organand in particular, vascular damage. Ann Transplant 2004, 9:31-32.41. ... was invaluable. Alanine aminopeptidase andb-N-acetylglucosaminidase are found in kidney tubularcell s br ush border and their presence in urine is a com-monly accepted sign of tubular damage ... their activ-ity level in the urine revealed a superiority of MP in maintaining tissue integrity at all time point, which wasconfirmed by histological analysis of the graftsparenchyma.Early...
- 13
- 370
- 0
Báo cáo hóa học: "Research Article Segmentation, Reconstruction, and Analysis of Blood Thrombus Formation in 3D 2-Photon Microscopy Images" pot
... and P. R. Bergstresser,“Mining biomedical images with density-based clustering,” in Proceedings of International Conference on InformationTechnology: Coding and Computing (ITCC ’05), vol. 1, ... attaindifferent levels of details of the clot surface. The α-shape of the point cloud degenerates to the input point set as the value of α approaches to 0, and it becomes the convex hull of theinput ... purpose. In different imaging settings,the users may estimate the percentage of the undesiredpoints (the undesired points may be noise, or as in ourapplication, scattered points of interest) and...
- 8
- 251
- 0
Báo cáo sinh học: "Comprehensive curation and analysis of global interaction networks in Saccharomyces cerevisiae" doc
... for interrogation of gene and protein function, including DNA microarrays for global gene-expression profiling and location of DNA-bindingfactors, and a comprehensive set of gene deletion strains ... number of interactions in the LC dataset (left) and standard HTP datasets (right).Protein-protein interactions, blue; gene-gene interactions, yellow. (b) The number of publications that contain interaction ... aquamarine; HTP-GI, pink. (d) Number of interactionsper publication in LC-GI and LC-PI datasets. Publications were binned by the number of interactions reported. The total number of papers and interactions...
- 28
- 351
- 0
Báo cáo y học: "Lack of association between glucocorticoid use and presence of the metabolic syndrome in patients with rheumatoid arthritis: a cross-sectional study" ppsx
... participated in the conception and design of the project and in the analysis and interpretation of data and contributedsubstantially to the drafting of the manuscript. VFP partici-pated in the ... notsignificant in the univariate analysis and had no impact on the frequency of the metabolic syndrome. Conclusion In summary, this study suggests that the presence of the met-abolic syndrome in RA appears ... It is therefore possible that, in RA patients, alterations in body fat/muscle may have already occurred as part of the dis-ease process and thus any additional changes that areinduced by long-term...
- 8
- 561
- 0
Báo cáo y học: "Expression and function of inducible co-stimulator in patients with systemic lupus erythematosus: possible involvement in excessive interferon-γ and anti-double-stranded DNA antibody production" pot
... http://arthritis-research.com/content/8/3/R62Page 1 of 14(page number not for citation purposes)Vol 8 No 3Research articleExpression and function of inducible co-stimulator in patients with systemic lupus erythematosus: possible involvement ... saline; PE = phycoerythrin; PerCP = peridinin chlorophyll protein; SD = standard deviation; SLE = systemic lupus erythematosus; SLEDAI = Systemic Lupus Erythematosus Disease Activity Index; Th = ... ICOS, inducible co-stimulator; mAb, monoclonal antibody; MFI, mean fluorescence intensity; NC, normal control; PE, phycoerythrin; PerCP, peridinin chlorophyll protein; SLE, sys-temic lupus erythematosus....
- 14
- 492
- 0
Báo cáo khoa học: " A dosimetric analysis of respiration-gated radiotherapy in patients with stage III lung cancer" pptx
... Fukuoka M, Kawahara M, et al.: Phase III study of con-current versus sequential thoracic radiotherapy in combina-tion with mitomycin, vindesine, and cisplatin in unresectable stage III non-small-cell ... motion and also respiration-gated PTVs in expira-tory phases. Of note is the finding that significant gainsare attained simply by using individualized 4D mobilitymargins (i.e. PTVall phases) instead ... theaccuracy of respiration-gated radiotherapy. Another approach explored for reducing toxicity is inten-sity-modulated radiotherapy (IMRT). A planning studycomparing IMRT and 3D conformal radiotherapy...
- 9
- 394
- 0
Báo cáo y học: "Lack of association between glucocorticoid use and presence of the metabolic syndrome in patients with rheumatoid arthritis: a cross-sectional study" pptx
... will have anincreased prevalence of each of the individual components of the metabolic syndrome (dyslipidaemia, hypertension, hyperg-lycaemia, and central obesity) as well as the metabolic syn-drome ... It is therefore possible that, in RA patients, alterations in body fat/muscle may have already occurred as part of the dis-ease process and thus any additional changes that areinduced by long-term ... Conversely,it may be that patients with RA have significantly modified theirrisk factors for the metabolic syndrome as a consequence of inflammation and that the addition of GC use cannot worsenthese...
- 8
- 531
- 0
báo cáo khoa học: " ’To take care of the patients’: Qualitative analysis of Veterans Health Administration personnel experiences with a clinical informatics system" ppsx
... article as: Bonner et al.: ’To take care of the patients’: Qualitative analysis of Veterans Health Administration personnel experiences with a clinical informatics system. Implementation Science2010 ... 5:63http://www.implementationscience.com/content/5/1/63Page 8 of 8 RESEARC H ARTIC LE Open Access ’To take care of the patients’: Qualitative analysis of Veterans Health Administration personnel experiences with a ... Angeles, CA, USA.7VA South Central MentalIllness Research, Education, and Clinical Center, Central Arkansas Veterans Healthcare System, North Little Rock, AR, USA.8University of Arkansas forMedical...
- 8
- 249
- 0
báo cáo khoa học: " Isolation, identification and expression analysis of salt-induced genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization" doc
... DnaJ-For5'GGAATACAGGAGGGG GACAT, Rev5'CCTTTTGGGAGAACCAAACA; BADH-For5'TGGAAAATTGCTCCAGCTCT, Rev5'CTGGACCTAATCCCGTCAAA; Actin-For5'AAACCACAAGCCCCTAAACC, Rev5'TTGCATCACTCAGCACCTTC. ... genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridizationBinod B Sahu* and Birendra P ShawAddress: Environmental Biotechnology Laboratory, Institute of ... domain in AMPK has greater affinity forAMP than for ATP, and as the cellular energy contentdrops (low ATP, high AMP), binding of AMP to CBSdomain of AMPK facilitates its phosphorylation makingthe...
- 25
- 292
- 0
Từ khóa: simulation and analysis of manufacturing systemscomputer image analysis of liver biopsy specimens in patients with heroin abuse and coinfection§ 709 10 treatment by conservator or liquidating agent of financial assets transferred in connection with a securitization or participationstress strain relation and analysis of viscoelastic stress of mass concretefinite element fem and boundary element models bemstochastic modeling and analysis of telecoms networksBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘITÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ