Báo cáo sinh học: "Synaptonemal complex behaviour in a bull homozygous for the 1;29 Robertsonian translocation" ppt

... studyreports the analysis of synaptonemal complex behaviour in spermatocytes from a bull homozygous carrier for the 1;29 Robertsonian translocation.MATERIALS AND METHODS The 1;29 Robertsonian ... Robertsonian translocation carrier examined in this study was a Blonded’Aquitaine bull. After hemicastration of the bull, the removed testis was immersedinto a container filled ... translocations in male carriers. In humans, the negative impact ofcertain Robertsonian translocations on male fertility has been attributed to the association between the...

báo cáo sinh học:" Continuity and change in human resources policies for health: lessons from Brazil" docx

... attracting and retaining hea lth staff in remoteand/or rural areas, tackling staff mal-distribution andover-specialisation, particularly in the physician work-force, retaining and motivating ... Pesquisa Económica Aplicada (CNRH/Ipea), in the financing agency Financiadora de Estudos e Projectos (Finep) and in the PREPS Program. In the late 1970s the BrazilianAssociation for Collective Health ... rural internships and the need to providetrained staff in underserved areas. In 1977, the firstmandatory rural internship was created in Minas Gerais. In 1976, PAHO, the MoH and the MoE initiatedPPREPS,...

Báo cáo sinh học: "Chromosomal inversion polymorphism in 2 marginal populations of the endemic Hawaiian species, Drosophila silvestris" pot

... in altitudinally marginal populations such as the one described from Hakalau. Thesefindings confirm earlier estimates for other Hawaiian species (Ayala 1975; Craddockand ... was sampled in January 1979 (Maulua-1) and again in October 1980 (Maulua-2) and Hakalau in March and November 1990, and April1991. The last 3 samples are homogeneous ... another, at least in part.Accordingly, the sequence of at least one of these asynapsed strands could be readby direct visual sequencing of the banding order. Reading...

Báo cáo sinh học: " Principal component approach in variance component estimation for international sire evaluation" pps

... (co)variancecomponents for international evaluation using AI-REML. Interbull Bull 2000, 25:46-50.8. Rekaya R, Weigel KA, Gianola D: Application of a structural model for genetic covariances in international dairy ... used for the directPC analyses, as well as for the variance component esti-mation in the bottom-up PC approach. The averageinformation REML algorithm was applied for bothapproaches. Bull ... necessary variation in the data. When a larger proportion of the variance in the eigenvalues was removed (ranks 7 and 6), the order of the countries added in the analysis affected the estimatesof...

Báo cáo sinh học: " Restricted maximum likelihood estimation of genetic parameters for the first three lactations in the Montbéliarde dairy cattle breed" pptx

... was first calculated and, after back transformation, the information matrix I of the original data was obtained as it can be showed that:where D is the (6 x 6) matrix ... weighted means of the estimates in the literature are 0.26 for first lactation, 0.20 for second lactation and 0.17 for third lactation (Maijalaand Hannah, 1974). In the first ... lactations. Reliable estimates of the genetic parameters for the different lactations are needed to appreciate this possible gain in accuracy.Data usually available for...

Báo cáo sinh học: " Performance evaluation of space-time-frequency spreading for MIMO OFDM-CDMA systems" ppt

... below). For information about publishing your research in EURASIP Journal on Advances in SignalProcessing go tohttp://asp.eurasipjournals.com/authors/instructions/ For information about other SpringerOpen ... (STF) spreading [10]. The main goal is to achieve higher diversity gains andincreased throughput by independently spreading data in STF with reasonable complexity. In addition, the system allows ... ˆxM], and M is the number of users.3is linearly proportional to the product of the S-domain, T-domain and the F-domain spreadingfactors. Therefore, the MIMO OFDM–CDMA system using STF-domain...

Báo cáo sinh học: " SNP mapping of QTL aﬀecting growth and fatness on chicken GGA1" pptx

... AGGGCTGACAGCTGGTTTTAACTTCCAACAGCCCATTCTG60 509 104M5 rs15245077 T/C CTGGCTGCAGGAGAGTAAGCAAGCTGCCAAACAAAACCAG60 489 207M6 rs13651060 A/ G CTGCTTGCAGACCTCTAGGCATACAGGCCAAGCACAGGAA62 439 115M7 ... rs15503250 A/ G AGTGCCTGTGAGGACAAACCCCAATCCACCAAAGATGTCC58 549 288M26 rs15520693 A/ G GAGAGAGCCTCCGCTAATGAGGACAATCTCCTCCCTCTCC60 464 89M27 rs15538603 A/ G ATGTACTGGGACTGCCTTGGTGCCACTTACACAGGTGCTC60 ... rs14937017 was low in the F2 family. After rul-ing out these two SNP, 28 informative SNP were available for analysis. In the F2, a genetic map was obtained using the CRI-MAP linkage programme [5].The...

Báo cáo sinh học: "Assessment of methods and analysis of outcomes for comprehensive optimization of nucleofection" pptx

... weconverted the raw data obtained from the secondary opti-mization to a standardized form, clustered the standard-ized data, and generated a heat map. The heat map allowsmany data sets to be ... optimizations. File containing raw data and standardized data produced in this study. The first sheet contains data from the primary optimization, and the second sheet contains data from the ... indicating high and low values. As seen on the scale, red indicates a high value relative to the mean of the individual data set, while green indicates a low value relative to the mean of the...

Báo cáo hóa học: " TWO TOPOLOGICAL DEFINITIONS OF A NIELSEN NUMBER FOR COINCIDENCES OF NONCOMPACT MAPS" pptx

... b e defined in a homotopic way instead. The homologic approach (if available) can then be used to provethat a certain class is essential (in the homotopic sense) and in this sense can be used ... Therefore, the taken approach is usually different: one di-vides the fixed point set into several (possibly empty) classes (induced by the map) andproves that certain “essential” classes remain ... remain stable under homotopies in the sense thattheclassesremainnonemptyanddifferent. The number of essential classes thus remainsstable and this is what is usually called the Nielsen number. In...

Báo cáo y học: "Inhaled activated protein C: a new therapy for the prevention of ventilator-induced lung injury" docx

... 204:2439-2448.6. Bae JS, Yang L, Rezaie AR: Receptors of the protein C activation and activated protein C signaling pathways are colocalized in lipid rafts of endothelial cells. Proc Natl Acad Sci U S A 2007, ... 1667.doi:10.1186/cc8977Cite this article as: Abraham E: Inhaled activated protein C: a new therapy for the prevention of ventilator-induced lung injury? Critical Care 2010, 14:144.Abraham Critical Care 2010, 14:144 ... diminishing the enhanced apoptosis of epithelial and other cell populations which accompanies acute lung injury. In the present experiments, treatment with APC was started before the initiation...

Xem thêm

Từ khóa: Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP