Báo cáo sinh học: "Results of a whole genome scan targeting QTL for growth and carcass traits in a Piétrain × Large White intercross" potx
Báo cáo sinh học: "Results of a whole genome scan targeting QTL for growth and carcass traits in a Piétrain × Large White intercross" potx
... articleResults of a whole genome scan targeting QTL for growth and carcass traits in a Piétrain × Large White intercrossCarine NEZER, Laurence MOREAU,Danny WAGENAAR, Michel GEORGES∗Department of ... herein report the results of a whole genome scan performed in a Piétrain × Large White intercross to map QTL in uencing growth and carcass traits. The identification of an imprinted QTL with major ... report the results of a whole genome scan performed in a Piétrain × Large White intercross counting 525 offspring to map QTL in uencing economically important growth and carcass traits. We report...
- 17
- 260
- 0
Báo cáo khóa học: Disruption of the interaction between the Rieske iron–sulfur protein and cytochrome b in the yeast bc1 complex owing to a human disease-associated mutation within cytochrome b potx
... glutamate (in yeast or humans) may affect thestructure of the hinge region, resulting in a hindered move-ment and enzyme instability. As suggested previously for a yeast mutant with a +1 alanine ... mitochondrial membranepreparations (data not shown). This could be a result of the instability of the mutant enzyme and an increasedsensitivity to degradation during membrane preparation,as discussed ... binding, as a result of theintroduction of a bulky and potentially charged glutamateresidue at position 167, may also explain the variations in the ISP content observed in different membrane...
- 7
- 498
- 0
Báo cáo sinh học: " Convergence of the modified Mann''''s iterative method for asymptotically kappa-strictly pseudocontractive mappings" pptx
... pseudocontractive mappings; demiclosedness prin-ciple; the modified Mann’s algorithm; fixed points.1 IntroductionLet E and E∗be a real Banach space and the dual space of E, respectively. Let K be a nonempty ... asymptotically κ-strictly pseudocontractive mappings and the class of κ-strictly pseudocontractive mappings are independent. A mapping T is said to be uniformly L-Lipschitzian if there exists a constant ... versions will be made available soon.Convergence of the modified Mann's iterative method for asymptoticallykappa-strictly pseudocontractive mappingsFixed Point Theory and Applications 2011,...
- 14
- 308
- 0
Báo cáo sinh học: " Comparisons of the M1 genome segments and encoded µ2 proteins of different reovirus isolates" pptx
... 2304T2S59 GCGUGAUCCGUGACAUGCGUAGUAUGACACCUGCCCCCAGGUCAAAGGGGGUAGGGGGCGGGCUAAGACUACGUACGCGCUUCAUC 2304T3C12 GCGUGAUCCGUGACAUGCGUAGUGUGACACCUGCUCCUAGGUCAAUGGGGGUAGGGGGCGGGCUAAGACUACGUACGCGCUUCAUC 2304T3C18 ... 2304T1L GCGUGAUCCGUGACAUGCGUAGUGUGACACCUGCCCCUAGGUCAAUGGGGGUAGGGGGCGGGCUAAGACUACGUACGCGCUUCAUC 2304T2J GCGUGAGUCGGGUCAUGCAACGUCGAACACCUGCCCCAUGGUCAAUGGGGGUAGGGG CGGGCUAAGACUACGUACGCGCUUCAUC 2303T3D ... 2304T1C11 GCGUGAUCCGUGACAUGCGUAGUGUGACACCUGCCCCUAGGUCAAUGGGGGUAGGGGGCGGGCUAAGACUACGUACGCGCUUCAUC 2304T1C29 GCGUGAUCCGUGACAUGCGUAGUGUGACACCUGCCCCUAGGUCAAUGGGGGUAGGGGGCGGGCUAAGACUACGUACGCGCUUCAUC 2304T1N84...
- 17
- 379
- 0
Báo cáo sinh học: " Typing of human rotaviruses: Nucleotide mismatches between the VP7 gene and primer are associated with genotyping failure" pdf
... strains. The G1 rotavirus VP7 gene specific primers were described by Das et al. [2] and Gouvea et al. [6]. Mismatches are in red.TCTTGTCAAAGCAAATAATA3’5’Das primer, 9T1-1CAAGTACTCAAATCAATGATGG5’3’Gouvea ... 9T1-1CAAGTACTCAAATCAATGATGG5’3’Gouvea primer, aBT1Target sequenceTarget sequenceCAAGTACTCAAATCAGTGATGGTTTAGTTAAGGCAAATAATABioMed CentralPage 1 of 5(page number not for citation purposes)Virology JournalOpen ... specimen using a solid phase sand-wich type enzyme immunoassay modelled after Dako-patts commercial kit incorporating rabbit hyperimmuneantisera produced at ICDDR,B and an anti-human rotavi-rus-horseradish...
- 5
- 389
- 0
báo cáo hóa học: " Inhibition of NF-κB activation by 5-lipoxygenase inhibitors protects brain against injury in a rat model of focal cerebral ischemia" docx
... 5'-ggaggaatgggagtt-gctgttgaa-3'; iNOS, forward primer, 5'-ggaagaggaacaactactgctggt-3', reverse primer, 5'-gaactgaggg-tacatgctggagc-3'. Thermal cycling conditions were as ... AccessResearchInhibition of NF-κB activation by 5-lipoxygenase inhibitors protects brain against injury in a rat model of focal cerebral ischemiaManu Jatana1, Shailendra Giri1, Mubeen A Ansari1, Chinnasamy ... Gabriel C, Justicia C, Camins A, Planas AM: Activation of nuclearfactor-kappaB in the rat brain after transient focal ischemia.Brain Res Mol Brain Res 1999, 65:61-69.42. Zhang W, Potrovita...
- 13
- 474
- 0
Báo cáo sinh học: " Prediction of breeding values with additive animal models for crosses from 2 populations" ppt
... offspring of 5 and 6, the latter being an Fl dam with unknownparents. Individuals 1, 4 and 5 are males and the rest are females. Age at measure and observed data for ... specification of the variance-covariance matrix for additive and dominance effects in crosses of 2 populationscan involve as many as 25 parameters for a single trait (Lo ... model of evaluation includes fixed effects of age (as a covariate), sex and genetic groups (Al, A2 and B), and random BV for animals 1 through 7. In order for [X:ZQ]...
- 12
- 311
- 0
Báo cáo y học: "Use of near-infrared light to reduce symptoms associated with restless legs syndrome in a woman: a case repor" ppt
... and usual rapid and dramatic improvement of the symptoms [6]. Otherdrugs, such as opioids (methadone, hydrocodone),GABA analogue (gabapentin, pregabalin), and ben zodia-zepi nes (clonazepam) ... of this treatment.ConsentWritten informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the writtenconsent is available for ... available for healthcareproviders. Anodyne is FDA approved for incr easing cir-culation and reducing pain, and it has been successf ullyused in wound management [11]. Researchers hypothe-size that...
- 5
- 318
- 0
Báo cáo y học: " Use of near-infrared light to reduce symptoms associated with restless legs syndrome in a woman: a case report" docx
... butthere are other similar devices available for healthcareproviders. Anodyne is FDA approved for incr easing cir-culation and reducing pain, and it has been successf ullyused in wound management ... the treatment of RLS.Now ropinirole and pramipexole, both dopamine ago-nists, are available . Unfortunately these drugs can causeinsomnia, nausea, dyspepsia, and dizziness [8]. Since thedrugs ... of this treatment.ConsentWritten informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the writtenconsent is available for...
- 5
- 227
- 0
Báo cáo y học: "Effects of monoclonal anti-PcrV antibody on Pseudomonas aeruginosa-induced acute lung injury in a rat model" ppt
... study, and partici-pated in its design and coordination. All authors read and approved the final manuscript.AbbreviationsP. aeruginosa:Pseudomonas aeruginosa, IT: IntratrachealadministrationAcknowledgementsThis ... had the sametherapeutic potency as the whole IgG and the therapeuticadministration of Fab fragments may overcome the disad-vantages of the intratracheal administration of whole IgG.Since the ... co-instillation of Mab166 with P. aeruginosawas the most protective.Therapeutic administration of Mab166 intratracheally protects against P. aeruginosa-induced acute lung injuryNext, we evaluated...
- 9
- 363
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP