Báo cáo sinh học: " Cloning and expression profiling of the VLDLR gene associated with egg performance in duck (Anas platyrhynchos)" docx
Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf
... et al. Rainbow trout interleukin-11 FEBS Journal 272 (2005) 11361147 ê 2005 FEBS 1137 Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss Tiehui ... (NQT) are in bold and underlined. The four potential poly(A) signals (AATAAA) in the 3Â-UTR and the TATAbox in the 5Â-anking region are boxed.T. Wang et al. Rainbow trout interleukin-11 FEBS ... isolated and sequenced, and the expression and modulation of this molecule wasstudied.Results Cloning and characterization of rainbow trout IL-11A cDNA clone containing a 2936 bp insert has...
- 12
- 511
- 0
Báo cáo Y học: Cloning and expression of sterol D14-reductase from bovine liver potx
... 38-kDa bovine protein is aể FEBS 2002 Bovine sterol D14-reductase cloning (Eur. J. Biochem. 269) 285 Cloning and expression of sterol D14-reductase from bovine liver Rita Roberti1, Anna Maria ... verify our hypothesis, bovine cDNA encodingthe 38-kDa protein was cloned to iden tify the catalyticactivity of the expressed protein. Cloning of the cDNA encoding bovine sterol D14-reductase Bovine ... similarity withD14-SR from yeasts, fungi, and plants (55±59%), sug-gesting that the bovine cDNA encodes D14-SR. Northernblot analysis of bovine tissues showed high expression of mRNA in liver and...
- 8
- 493
- 0
Báo cáo khoa học: Cloning and expression of a tomato cDNA encoding a methyl jasmonate cleaving esterase pdf
... Cloning and expression of a tomato cDNA encoding a methyl jasmonate cleaving esterase Christiane Stuhlfelder, Martin J. Mueller and Heribert WarzechaLehrstuhl fuăr Pharmazeutische ... application of JA. These experiments demonstrate that individual mem-bers of the jasmonate family are involved – at least inArabidopsis – in different signalling pathways.An Arabidopsis(jar1)mutantwithadefectinthe jasmonate ... jasmonate; MJE, methyl jasmonate esterase; MeSA, methyl salicylate; OPD A , 12-oxo-phytodienoic acid; P I ,proteinase inhibitors; PNAE, polyneuridine aldehyde esterase; RACE, rapid amplification of...
- 8
- 458
- 1
Báo cáo Y học: Cloning and expression of two novel aldo-keto reductases from Digitalis purpurea leaves potx
... used asa control of sample loading.2848 I. Gavidia et al. (Eur. J. Biochem. 269) Ó FEBS 2002 Cloning and expression of two novel aldo-keto reductases from Digitalis purpurea leaves Isabel Gavidia1,2, ... two full-length cDNAs from D. purpurea leaves that encode DpAR1 and DpAR2, two new members of theAKR superfamily; specifically, the amino-acid sequences of DpARs show relatively high levels of ... enzymaticactivity on steroids, the organ-specific and developmen-tally regulated expression of the genes, and the specificbiosynthesis and accumulation of cardenolides in mature Digitalis leaves. ...
- 9
- 570
- 0
Báo cáo khoa học: Cloning and functional characterization of Arabidopsis thaliana D-amino acid aminotransferase – D-aspartate behavior during germination pdf
... the metabolism of d-Asp in the plant by catalyzing trans-amination between d-amino acids. This is the first report of cDNA cloning and functional characterization of a d-amino acid aminotransferase ... we report on thebiochemical behavior of d-amino acids (particularly d-Asp) and relevantmetabolic enzymes in Arabidopsis thaliana. During germination and growth of the plant, a transient increase ... ê 2008 FEBS Cloning and functional characterization of Arabidopsis thaliana D-amino acid aminotransferase – D-aspartate behavior during germination Miya Funakoshi1,*, Masae Sekine1,*, Masumi...
- 13
- 401
- 0
Báo cáo khoa học: Cloning and functional analysis of 5¢-upstream region of the Pokemon gene pptx
... for gene therapy in cancer.Results Cloning of the 5Â-upstream region of the Pokemon gene To identify the regulatory sequences that controlexpression of the Pokemon gene, a 2204-bp section of the ... To further determine the cooperation between the NEG-U and NEG-D elements, 2 lg of the NEG-U decoy, 2 lg of the NEG-D decoy, and acombination of 1 lg of each of the decoys were used, and the above-mentioned ... fragments of the upstream region of the Pokemon gene were inserted into the pGL3-basic vector and their ability toactivate transcription of the luciferase gene was assessed in A549 and DU145 cells. The...
- 14
- 340
- 0
Báo cáo khoa học: Characterization and expression analysis of the aspartic protease gene family of Cynara cardunculus L. docx
... gene regu-lation, by modulating the level of expression and ⁄ ordetermining the specific pattern of expression of a gene [34–39]. To evaluate the relevance of the leader intronin cardosin expression, ... library screening of four full-length genesencoding cardosins A, B, C and D precursors, togetherwith the cloning of a partial sequence of the cyprosin B gene and the isolation of the cyprosin A ... Dzelzkalns et al. (boxes I and III) within the promoter region of the SLG13 gene [40] also appear in the leader intron of the cardosin B gene. (B) A motif found in the S1, SLG, SLR1 and PR5 genes [41,42]...
- 17
- 359
- 0
Báo cáo khóa học: Cloning and expression of murine enzymes involved in the salvage pathway of GDP-L-fucose ppt
... of mouse fucokinase at the 3Â end.ể FEBS 2003 The salvage pathway of GDP-L-fucose in mouse (Eur. J. Biochem. 271)79 Cloning and expression of murine enzymes involved in the salvage pathway of GDP-L-fucoseL-fucokinase ... from porcinekidney and the corresponding gene has been cloned fromhuman [23]. In the present study we have cloned the murine genescoding for the enzymes involved in the salvage pathway of GDP-L-fucose.L-fucokinase ... http://www.ncbi.nlm.nih.gov/UniGene). Our analysis of the expression of the enzymes involved in the salvage pathway of GDP-L-fucose indicatesthat not only the de novo pathway alone, but also the salvage pathway could have...
- 9
- 437
- 0
Báo cáo khoa học: Cloning and functional characterization of Phaeodactylum tricornutum front-end desaturases involved in eicosapentaenoic acid biosynthesis doc
... silica-lessdiatom in which eicosapentaenoic acid accumulates up to30% of the total fatty acids. This marine diatom was used for cloning genes encoding fatty acid desaturases involved in eicosapentaenoic acid ... asD5- and D6-fatty acid desaturases. The substrate specificity of each enzyme was determined and confirmed theirinvolvement in eicosapentaenoic acid biosynthesis. Usingboth desaturases in combination ... characterization of Phaeodactylum tricornutum front-end desaturases involved in eicosapentaenoic acid biosynthesis Frederic Domergue1,*, Jens Lerchl2, Ulrich Zaă hringer3 and Ernst Heinz11Institut...
- 9
- 455
- 0
Báo cáo sinh học: "Molecular and cellular correlates of the CIITA-mediated inhibition of HTLV-2 Tax-2 transactivator function resulting in loss of viral replication" pot
... Orlandi et al.: Molecular and cellular correlates of the CIITA-mediated inhibition of HTLV-2 Tax-2 transactivator function resulting in loss of viral replication. Journal of Translational Medicine ... 9:106http://www.translational-medicine.com/content/9/1/106Page 9 of 9 RESEARC H Open AccessMolecular and cellular correlates of the CIITA-mediated inhibition of HTLV-2 Tax-2 transactivator function resulting in loss of viral ... rminal and a C-terminal region of CIITA interacting with the viral transactivator, although, as stated above, only the N-terminal region is involved in the inhibition of Tax-2 function. Interestingly,...
- 9
- 493
- 0
Báo cáo toán học: "Differential display identifies overexpression of the USP36 gene, encoding a deubiquitinating enzyme, in ovarian cancer" pot
... ggatccatttaggtgacactatagaagtacctgaaaggaagcttttttttttcgaggatttcctgtatttattaagttacaagttggcaggcacagcttgagcaacatagaaaagtaatcttcttgagttatacaatcatttaaattccaaagcactcacaaaattgagcaaacaaagccactatttgcatatttgggaaaggaaacatattgctaacgtaagcttcctgaatccttcatggcctatagtgagtcgtattagaattc-3’). The synthesized riboprobe was precipitated by ... measured by liquid scintillation analysis. The probe for USP36 is 130bp (5’- ttacaagttggcaggcacagcttgagcaacatagaaaagt aatcttcttgagttatacaatcatttaaattccaaagcactcacaaaattgagcaaacaaagccactatttgcatatttgggaaaggaaa-3’). ... The generated antisense probe for USP36 is 267bp (5’- ggatccatttaggtgacactatagaagtacctgaaaggaagcttttttttttcgaggatttcctgtatttattaagttacaagttggcaggcacagcttgagcaacatagaaaagtaatcttcttgagttatacaatcatttaaattccaaagcactcacaaaattgagcaaacaaagccactatttgcatatttgggaaaggaaacatattgctaacgtaagcttcctgaatccttcatggcctatagtgagtcgtattagaattc-3’)....
- 10
- 246
- 0
Báo cáo y học: "Rapid and persistent selection of the K103N mutation as a majority quasispecies in a HIV1-patient exposed to efavirenz for three weeks: a case report and review of the literature" pot
... persistent selection of the K103N mutation as a majority quasispecies in a HIV1-patient exposed to efavirenz for three weeks: a case report and review of the literatureEnnio Polilli1, Giustino Parruti2*, ... strain as the dominant quasispecies after very short exposure to efavirenz in vivo. Case presentation: A 55-year-old Caucasian man was switched to efavirenz, zidovudine and lamivudine in February ... K103N mutation persisted for six years as dominant quasispecies, in the absence of selective pressure, after administration of EFV for a year and a half. In such a case, the authorspostulated a...
- 5
- 427
- 0
Báo cáo sinh học: " Genetic and morphological characterisation of the Ankole Longhorn cattle in the African Great Lakes region" pptx
... 0.01, and ***P < 0.001. Genetic and morphological characterisation of the Ankole cattle 471 Original article Genetic and morphological characterisation of the Ankole Longhorn cattle in the African ... disease and other stresses in improvement of ruminant livestock in the tropics, in: Proceedings of the 5th Genetic and morphological characterisation of the Ankole cattle 487 at TGLA122 , while the ... corresponding to the square root of the sum of the squared dis-tances between the centroid (i.e. centre of gravity of the landmarks) and each of the c onfigured landmarks. Then, the centroids of all...
- 24
- 349
- 0
Báo cáo sinh học: " Cloning and expression profiling of the VLDLR gene associated with egg performance in duck (Anas platyrhynchos)" docx
... Access Cloning and expression profiling of the VLDLR gene associated with egg performance in duck (Anas platyrhynchos)Cui Wang, Shi-jun Li, Wen-hua Yu, Qing-wu Xin, Chuang Li, Yan-ping Feng, ... ligand binding motifs(S-D-E) and eight cysteine-rich repeats within the ligandbinding domain; (ii) five YWXD motifs in the EGF pre-cursor homology domain; (iii) an O-linked sugar domain with ... are present in heart, one (VLDLR- a) with an O-linked sugar domain and the other (VLDLR- b)without.ThepredictionresultsfromtheSwissInstituteofBioinformatics software showed that the VLDLR- a (Gen-Bank:...
- 9
- 487
- 0
Báo cáo y học: "Characterization and comparative profiling of the small RNA transcriptomes in two phases of locust" docx
... group, the study of small RNAs in the hemimetabolousgroup, including several ancient orders of insects, could aid in understanding the whole picture of evolution and function of small RNAs in insects. The ... understanding of the impact of these elements on genome evolution of the locust and related species.Classification of the rest of the small RNAs The rest of the sequences in the locust small RNA ... distribu-tions of the small RNAs, the proportions of each type of small RNA in the libraries between the two phases were different(Figure 1b). The proportion of miRNAs in the gregariousphase is nearly two...
- 18
- 364
- 0
Từ khóa: báo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptbài báo cáo sinh học thực vậtbáo cáo khoa học ảnh hưởng của việc thay thế cỏ xanh trong khẩu phần bằng bã dứa ủ chua đến khả năng sản xuất của bò thịt potmapping colocation and expression studies of the maize nced and zep gene familiesbáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcmẫu báo cáo trường học thân thiện học sinh tích cựcbáo cáo trường học thân thiện học sinh tích cực tiểu họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM